Incidental Mutation 'R6724:Pkn3'
ID 529735
Institutional Source Beutler Lab
Gene Symbol Pkn3
Ensembl Gene ENSMUSG00000026785
Gene Name protein kinase N3
Synonyms
MMRRC Submission 044842-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6724 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 29967696-29981034 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 29980562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 818 (R818S)
Ref Sequence ENSEMBL: ENSMUSP00000041025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000081838] [ENSMUST00000102865]
AlphaFold Q8K045
Predicted Effect possibly damaging
Transcript: ENSMUST00000045246
AA Change: R818S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785
AA Change: R818S

DomainStartEndE-ValueType
Hr1 15 78 3.45e-17 SMART
Hr1 98 166 6.19e-19 SMART
Hr1 171 239 3.32e-19 SMART
low complexity region 528 537 N/A INTRINSIC
S_TKc 548 807 2.52e-93 SMART
S_TK_X 808 872 9.58e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081838
SMART Domains Protein: ENSMUSP00000080521
Gene: ENSMUSG00000015335

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Pfam:zf-DHHC 106 232 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102865
SMART Domains Protein: ENSMUSP00000099929
Gene: ENSMUSG00000015335

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:zf-DHHC 58 218 1.1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148717
Meta Mutation Damage Score 0.6123 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 T A 16: 85,665,445 (GRCm39) T619S probably benign Het
Adgra2 G A 8: 27,604,210 (GRCm39) A467T possibly damaging Het
Alox5 A T 6: 116,391,509 (GRCm39) I416N probably damaging Het
Blmh A G 11: 76,862,733 (GRCm39) probably null Het
Cftr T A 6: 18,255,973 (GRCm39) Y567* probably null Het
Cnr1 T A 4: 33,944,728 (GRCm39) M372K possibly damaging Het
Col6a3 T C 1: 90,706,874 (GRCm39) T2080A unknown Het
Crybg3 A T 16: 59,364,501 (GRCm39) C2374S probably benign Het
Csmd2 A G 4: 128,457,164 (GRCm39) I3544V probably damaging Het
Dnah12 A T 14: 26,518,180 (GRCm39) D1809V probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dnajb12 A G 10: 59,728,602 (GRCm39) D190G possibly damaging Het
Dtnb T A 12: 3,736,817 (GRCm39) V319D probably damaging Het
Eif1ad6 A T 12: 87,668,754 (GRCm39) I129F unknown Het
Ercc6 A T 14: 32,288,288 (GRCm39) E820V probably benign Het
Fip1l1 T G 5: 74,752,435 (GRCm39) V378G probably damaging Het
Gabrg1 T A 5: 70,911,552 (GRCm39) Y358F possibly damaging Het
Gcn1 T G 5: 115,747,217 (GRCm39) probably null Het
Gm11011 T A 2: 169,429,402 (GRCm39) T28S unknown Het
Guf1 C A 5: 69,723,736 (GRCm39) N438K probably damaging Het
Hoxa7 T C 6: 52,192,719 (GRCm39) E223G probably benign Het
Hspg2 G A 4: 137,242,618 (GRCm39) G611E probably damaging Het
Ipo8 A T 6: 148,711,473 (GRCm39) probably null Het
Isl2 A G 9: 55,448,572 (GRCm39) D3G possibly damaging Het
Kcnb2 A G 1: 15,780,664 (GRCm39) Y512C probably damaging Het
Kifc1 T A 17: 34,105,707 (GRCm39) probably null Het
Klhdc10 A G 6: 30,446,640 (GRCm39) D183G probably damaging Het
Klra5 T A 6: 129,883,643 (GRCm39) K71N probably benign Het
Lrp6 T C 6: 134,463,504 (GRCm39) H559R possibly damaging Het
Maml3 T C 3: 51,763,296 (GRCm39) N556S probably damaging Het
Man2a1 A G 17: 65,038,264 (GRCm39) I83V possibly damaging Het
Mrgpra9 A G 7: 46,884,786 (GRCm39) S293P probably damaging Het
Nalcn A G 14: 123,535,479 (GRCm39) S1282P probably damaging Het
Npepps A T 11: 97,096,828 (GRCm39) probably benign Het
Or4a72 A T 2: 89,405,309 (GRCm39) F254I probably benign Het
Or4c108 T G 2: 88,803,612 (GRCm39) I208L probably benign Het
Or8u10 A T 2: 85,915,701 (GRCm39) V140E possibly damaging Het
Or9m1 T G 2: 87,733,946 (GRCm39) S25R probably benign Het
Plekha3 T A 2: 76,517,745 (GRCm39) H190Q probably damaging Het
Ppp2r3c A T 12: 55,335,281 (GRCm39) S261T probably benign Het
Ptprj T C 2: 90,281,195 (GRCm39) D1015G probably benign Het
Pus10 T C 11: 23,679,037 (GRCm39) M503T possibly damaging Het
Pvr T C 7: 19,652,604 (GRCm39) R104G possibly damaging Het
Rubcnl A G 14: 75,289,450 (GRCm39) R653G probably benign Het
Semp2l2a A T 8: 13,887,083 (GRCm39) L336Q probably damaging Het
Serpina1a G T 12: 103,826,679 (GRCm39) probably benign Het
Shank3 G A 15: 89,416,656 (GRCm39) R265Q probably damaging Het
Slc22a22 C T 15: 57,110,928 (GRCm39) R433H probably damaging Het
Slc22a26 A G 19: 7,779,726 (GRCm39) I30T probably benign Het
Spz1 A T 13: 92,711,992 (GRCm39) N161K possibly damaging Het
Tacc2 A G 7: 130,330,492 (GRCm39) R259G probably damaging Het
Top1 G A 2: 160,554,616 (GRCm39) V456M probably damaging Het
Tpcn2 G A 7: 144,810,257 (GRCm39) A649V probably benign Het
Trank1 C G 9: 111,194,984 (GRCm39) R1003G probably damaging Het
Tril T A 6: 53,796,559 (GRCm39) H221L possibly damaging Het
Unc79 C T 12: 103,071,120 (GRCm39) T1305I probably damaging Het
Unc80 C T 1: 66,722,350 (GRCm39) A2988V possibly damaging Het
Vinac1 A C 2: 128,879,976 (GRCm39) V650G probably benign Het
Vmn1r81 A T 7: 11,994,599 (GRCm39) M3K probably damaging Het
Vmn2r78 A T 7: 86,603,466 (GRCm39) D548V probably damaging Het
Vwa3b G A 1: 37,084,112 (GRCm39) R95Q probably damaging Het
Wdr6 G A 9: 108,452,093 (GRCm39) H597Y probably benign Het
Yme1l1 C T 2: 23,084,774 (GRCm39) T624I probably damaging Het
Other mutations in Pkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Pkn3 APN 2 29,971,116 (GRCm39) missense probably damaging 0.97
IGL00781:Pkn3 APN 2 29,973,402 (GRCm39) unclassified probably benign
IGL00815:Pkn3 APN 2 29,971,212 (GRCm39) missense possibly damaging 0.88
IGL01576:Pkn3 APN 2 29,977,054 (GRCm39) missense probably damaging 1.00
IGL01897:Pkn3 APN 2 29,972,824 (GRCm39) unclassified probably benign
IGL02513:Pkn3 APN 2 29,973,149 (GRCm39) missense probably damaging 0.98
IGL02552:Pkn3 APN 2 29,970,879 (GRCm39) missense probably damaging 1.00
IGL02622:Pkn3 APN 2 29,973,158 (GRCm39) missense probably benign 0.28
IGL02689:Pkn3 APN 2 29,970,858 (GRCm39) missense probably damaging 1.00
IGL02996:Pkn3 APN 2 29,970,627 (GRCm39) missense probably benign 0.39
IGL03106:Pkn3 APN 2 29,975,257 (GRCm39) missense probably damaging 0.96
Enflamme UTSW 2 29,973,049 (GRCm39) unclassified probably benign
Wrath UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
PIT4151001:Pkn3 UTSW 2 29,980,539 (GRCm39) missense probably damaging 1.00
R0279:Pkn3 UTSW 2 29,973,309 (GRCm39) missense probably benign 0.16
R0370:Pkn3 UTSW 2 29,977,184 (GRCm39) missense probably damaging 1.00
R0491:Pkn3 UTSW 2 29,979,889 (GRCm39) missense probably damaging 1.00
R0600:Pkn3 UTSW 2 29,971,146 (GRCm39) missense probably benign 0.06
R1418:Pkn3 UTSW 2 29,973,059 (GRCm39) missense probably damaging 1.00
R1510:Pkn3 UTSW 2 29,969,776 (GRCm39) critical splice donor site probably null
R1535:Pkn3 UTSW 2 29,977,065 (GRCm39) missense probably benign
R1540:Pkn3 UTSW 2 29,974,703 (GRCm39) missense probably damaging 1.00
R1808:Pkn3 UTSW 2 29,969,663 (GRCm39) missense probably damaging 1.00
R1884:Pkn3 UTSW 2 29,972,840 (GRCm39) missense probably damaging 1.00
R1995:Pkn3 UTSW 2 29,979,989 (GRCm39) missense probably damaging 1.00
R3745:Pkn3 UTSW 2 29,980,353 (GRCm39) missense probably damaging 1.00
R4119:Pkn3 UTSW 2 29,973,049 (GRCm39) unclassified probably benign
R4258:Pkn3 UTSW 2 29,978,572 (GRCm39) missense probably damaging 0.99
R4665:Pkn3 UTSW 2 29,975,469 (GRCm39) unclassified probably benign
R4772:Pkn3 UTSW 2 29,974,692 (GRCm39) splice site probably null
R4808:Pkn3 UTSW 2 29,980,093 (GRCm39) missense probably damaging 1.00
R5038:Pkn3 UTSW 2 29,975,293 (GRCm39) critical splice donor site probably null
R5388:Pkn3 UTSW 2 29,971,086 (GRCm39) missense probably damaging 0.99
R5488:Pkn3 UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
R5611:Pkn3 UTSW 2 29,969,673 (GRCm39) missense probably damaging 1.00
R6001:Pkn3 UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
R6277:Pkn3 UTSW 2 29,972,957 (GRCm39) missense possibly damaging 0.93
R6562:Pkn3 UTSW 2 29,970,699 (GRCm39) critical splice donor site probably null
R7061:Pkn3 UTSW 2 29,973,548 (GRCm39) splice site probably null
R7128:Pkn3 UTSW 2 29,973,327 (GRCm39) missense probably damaging 1.00
R7249:Pkn3 UTSW 2 29,974,773 (GRCm39) missense probably benign 0.00
R7475:Pkn3 UTSW 2 29,977,122 (GRCm39) missense probably benign 0.01
R7746:Pkn3 UTSW 2 29,980,596 (GRCm39) missense probably benign 0.00
R7747:Pkn3 UTSW 2 29,980,596 (GRCm39) missense probably benign 0.00
R7783:Pkn3 UTSW 2 29,969,634 (GRCm39) missense probably damaging 1.00
R8401:Pkn3 UTSW 2 29,970,071 (GRCm39) missense probably benign 0.00
R8425:Pkn3 UTSW 2 29,976,513 (GRCm39) critical splice donor site probably null
R8535:Pkn3 UTSW 2 29,969,936 (GRCm39) critical splice acceptor site probably null
R8720:Pkn3 UTSW 2 29,975,196 (GRCm39) missense probably benign 0.01
R8743:Pkn3 UTSW 2 29,973,318 (GRCm39) missense probably benign 0.00
R9415:Pkn3 UTSW 2 29,968,332 (GRCm39) missense probably benign 0.20
R9437:Pkn3 UTSW 2 29,973,267 (GRCm39) missense possibly damaging 0.93
R9583:Pkn3 UTSW 2 29,976,723 (GRCm39) missense probably null 0.99
R9800:Pkn3 UTSW 2 29,973,290 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCGAGGAGATCAAGGTTCAAC -3'
(R):5'- ACATGGTTACGTGGAGGCTTC -3'

Sequencing Primer
(F):5'- CAAGGTTCAACCATTCTTCAGGG -3'
(R):5'- TGAAGTGCCAGGAGACCCTC -3'
Posted On 2018-08-01