Mutagenetix > Incidental Mutations

Incidental Mutation 'R6724:Olfr1154'

529738

Institutional Source

Beutler Lab

Gene Symbol

Olfr1154

Ensembl Gene

ENSMUSG00000075146

Gene Name

olfactory receptor 1154

Synonyms

GA_x6K02T2Q125-49403456-49402524, MOR173-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R6724 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87901256-87905166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 87903602 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 25 (S25R)

Ref Sequence

ENSEMBL: ENSMUSP00000148909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099844] [ENSMUST00000215017] [ENSMUST00000215862]

Predicted Effect

probably benign
Transcript: ENSMUST00000099844
AA Change: S25R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000097432
Gene: ENSMUSG00000075146
AA Change: S25R

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	8.1e-47	PFAM
Pfam:7tm_1	41	289	3.6e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215017
AA Change: S25R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000215862
AA Change: S25R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts5	T	A	16: 85,868,557	T619S	probably benign	Het
Adgra2	G	A	8: 27,114,182	A467T	possibly damaging	Het
AF366264	A	T	8: 13,837,083	L336Q	probably damaging	Het
Alox5	A	T	6: 116,414,548	I416N	probably damaging	Het
Blmh	A	G	11: 76,971,907		probably null	Het
Cftr	T	A	6: 18,255,974	Y567*	probably null	Het
Cnr1	T	A	4: 33,944,728	M372K	possibly damaging	Het
Col6a3	T	C	1: 90,779,152	T2080A	unknown	Het
Crybg3	A	T	16: 59,544,138	C2374S	probably benign	Het
Csmd2	A	G	4: 128,563,371	I3544V	probably damaging	Het
Dnah12	A	T	14: 26,796,223	D1809V	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dnajb12	A	G	10: 59,892,780	D190G	possibly damaging	Het
Dtnb	T	A	12: 3,686,817	V319D	probably damaging	Het
Ercc6	A	T	14: 32,566,331	E820V	probably benign	Het
Fip1l1	T	G	5: 74,591,774	V378G	probably damaging	Het
Gabrg1	T	A	5: 70,754,209	Y358F	possibly damaging	Het
Gcn1l1	T	G	5: 115,609,158		probably null	Het
Gm11011	T	A	2: 169,587,482	T28S	unknown	Het
Gm13762	T	G	2: 88,973,268	I208L	probably benign	Het
Gm14025	A	C	2: 129,038,056	V650G	probably benign	Het
Gm4027	A	T	12: 87,621,984	I129F	unknown	Het
Guf1	C	A	5: 69,566,393	N438K	probably damaging	Het
Hoxa7	T	C	6: 52,215,739	E223G	probably benign	Het
Hspg2	G	A	4: 137,515,307	G611E	probably damaging	Het
Ipo8	A	T	6: 148,809,975		probably null	Het
Isl2	A	G	9: 55,541,288	D3G	possibly damaging	Het
Kcnb2	A	G	1: 15,710,440	Y512C	probably damaging	Het
Kifc1	T	A	17: 33,886,733		probably null	Het
Klhdc10	A	G	6: 30,446,641	D183G	probably damaging	Het
Klra5	T	A	6: 129,906,680	K71N	probably benign	Het
Lrp6	T	C	6: 134,486,541	H559R	possibly damaging	Het
Maml3	T	C	3: 51,855,875	N556S	probably damaging	Het
Man2a1	A	G	17: 64,731,269	I83V	possibly damaging	Het
Mrgpra9	A	G	7: 47,235,038	S293P	probably damaging	Het
Nalcn	A	G	14: 123,298,067	S1282P	probably damaging	Het
Npepps	A	T	11: 97,206,002		probably benign	Het
Olfr1037	A	T	2: 86,085,357	V140E	possibly damaging	Het
Olfr1245	A	T	2: 89,574,965	F254I	probably benign	Het
Pkn3	C	A	2: 30,090,550	R818S	possibly damaging	Het
Plekha3	T	A	2: 76,687,401	H190Q	probably damaging	Het
Ppp2r3c	A	T	12: 55,288,496	S261T	probably benign	Het
Ptprj	T	C	2: 90,450,851	D1015G	probably benign	Het
Pus10	T	C	11: 23,729,037	M503T	possibly damaging	Het
Pvr	T	C	7: 19,918,679	R104G	possibly damaging	Het
Rubcnl	A	G	14: 75,052,010	R653G	probably benign	Het
Serpina1a	G	T	12: 103,860,420		probably benign	Het
Shank3	G	A	15: 89,532,453	R265Q	probably damaging	Het
Slc22a22	C	T	15: 57,247,532	R433H	probably damaging	Het
Slc22a26	A	G	19: 7,802,361	I30T	probably benign	Het
Spz1	A	T	13: 92,575,484	N161K	possibly damaging	Het
Tacc2	A	G	7: 130,728,762	R259G	probably damaging	Het
Top1	G	A	2: 160,712,696	V456M	probably damaging	Het
Tpcn2	G	A	7: 145,256,520	A649V	probably benign	Het
Trank1	C	G	9: 111,365,916	R1003G	probably damaging	Het
Tril	T	A	6: 53,819,574	H221L	possibly damaging	Het
Unc79	C	T	12: 103,104,861	T1305I	probably damaging	Het
Unc80	C	T	1: 66,683,191	A2988V	possibly damaging	Het
Vmn1r81	A	T	7: 12,260,672	M3K	probably damaging	Het
Vmn2r78	A	T	7: 86,954,258	D548V	probably damaging	Het
Vwa3b	G	A	1: 37,045,031	R95Q	probably damaging	Het
Wdr6	G	A	9: 108,574,894	H597Y	probably benign	Het
Yme1l1	C	T	2: 23,194,762	T624I	probably damaging	Het

Other mutations in Olfr1154

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Olfr1154	APN	2	87903527	missense	probably benign	0.00
IGL01878:Olfr1154	APN	2	87903331	nonsense	probably null
IGL02683:Olfr1154	APN	2	87903104	missense	possibly damaging	0.80
IGL02836:Olfr1154	APN	2	87903380	missense	possibly damaging	0.81
R0432:Olfr1154	UTSW	2	87902960	missense	probably damaging	1.00
R1123:Olfr1154	UTSW	2	87902904	missense	probably damaging	0.99
R1223:Olfr1154	UTSW	2	87902819	missense	probably damaging	0.99
R1561:Olfr1154	UTSW	2	87903161	missense	probably benign	0.00
R1964:Olfr1154	UTSW	2	87903667	missense	probably benign	0.00
R2041:Olfr1154	UTSW	2	87902797	missense	probably damaging	1.00
R2219:Olfr1154	UTSW	2	87902925	nonsense	probably null
R2233:Olfr1154	UTSW	2	87903475	missense	probably damaging	1.00
R3719:Olfr1154	UTSW	2	87903103	missense	probably benign	0.05
R4826:Olfr1154	UTSW	2	87903349	missense	probably damaging	1.00
R4908:Olfr1154	UTSW	2	87903189	missense	probably damaging	1.00
R5056:Olfr1154	UTSW	2	87903571	missense	probably damaging	1.00
R5589:Olfr1154	UTSW	2	87903347	missense	probably benign	0.26
R6477:Olfr1154	UTSW	2	87902990	missense	probably damaging	1.00
R6532:Olfr1154	UTSW	2	87903202	missense	probably damaging	1.00
R6666:Olfr1154	UTSW	2	87903508	missense	probably damaging	1.00
R6693:Olfr1154	UTSW	2	87903308	missense	probably damaging	1.00
R7784:Olfr1154	UTSW	2	87903193	missense	probably benign	0.01
Z1088:Olfr1154	UTSW	2	87903584	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CCTTCTTGTCAGAAATCAGATCCAC -3'
(R):5'- GCACACTGAGTAACCATTTGAC -3'

Sequencing Primer
(F):5'- GAAATCAGATCCACAAGTAATTTGGG -3'
(R):5'- CCATTTGACAATGATGGTAGAAAGC -3'

Posted On

2018-08-01