Mutagenetix > Incidental Mutation

Incidental Mutation 'R6724:Ptprj'

529741

Institutional Source

Beutler Lab

Gene Symbol

Ptprj

Ensembl Gene

ENSMUSG00000025314

Gene Name

protein tyrosine phosphatase, receptor type, J

Synonyms

CD148, Byp, Scc1, Scc-1, DEP-1, RPTPJ

MMRRC Submission

044842-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.186) question?

Stock #

R6724 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90429754-90580647 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 90450851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1015 (D1015G)

Ref Sequence

ENSEMBL: ENSMUSP00000129592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111493] [ENSMUST00000111495] [ENSMUST00000168621]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000111493
AA Change: D829G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000107119
Gene: ENSMUSG00000025314
AA Change: D829G

Domain	Start	End	E-Value	Type
low complexity region	34	46	N/A	INTRINSIC
FN3	47	182	3.76e-6	SMART
FN3	194	271	4.56e-5	SMART
FN3	282	357	5.32e-6	SMART
FN3	368	446	2.19e-7	SMART
FN3	455	531	5e-2	SMART
FN3	546	628	2.77e1	SMART
low complexity region	637	650	N/A	INTRINSIC
Blast:PTPc	714	797	8e-26	BLAST
PTPc	867	1127	3.37e-133	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111495
AA Change: D922G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000107121
Gene: ENSMUSG00000025314
AA Change: D922G

Domain	Start	End	E-Value	Type
low complexity region	14	25	N/A	INTRINSIC
FN3	59	131	2.85e-6	SMART
FN3	140	275	3.76e-6	SMART
FN3	287	364	4.56e-5	SMART
FN3	375	450	5.32e-6	SMART
FN3	461	539	2.19e-7	SMART
FN3	548	624	5e-2	SMART
FN3	639	721	2.77e1	SMART
low complexity region	730	743	N/A	INTRINSIC
Blast:PTPc	807	890	1e-25	BLAST
PTPc	960	1220	3.37e-133	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168621
AA Change: D1015G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000129592
Gene: ENSMUSG00000025314
AA Change: D1015G

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
low complexity region	26	94	N/A	INTRINSIC
low complexity region	133	140	N/A	INTRINSIC
FN3	152	224	2.85e-6	SMART
FN3	233	368	3.76e-6	SMART
FN3	380	457	4.56e-5	SMART
FN3	468	543	5.32e-6	SMART
FN3	554	632	2.19e-7	SMART
FN3	641	717	5e-2	SMART
FN3	732	814	2.77e1	SMART
low complexity region	823	836	N/A	INTRINSIC
Blast:PTPc	900	983	1e-25	BLAST
PTPc	1053	1313	3.37e-133	SMART

Meta Mutation Damage Score

0.0671

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. This protein is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die in utero displaying severe growth retardation and cardiovascular defects. Homozygotes for a second null allele are viable, fertile and healthy with no spontaneous tumor formation. Homozygotes for a third null allele show sterility and a block B cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts5	T	A	16: 85,868,557	T619S	probably benign	Het
Adgra2	G	A	8: 27,114,182	A467T	possibly damaging	Het
AF366264	A	T	8: 13,837,083	L336Q	probably damaging	Het
Alox5	A	T	6: 116,414,548	I416N	probably damaging	Het
Blmh	A	G	11: 76,971,907		probably null	Het
Cftr	T	A	6: 18,255,974	Y567*	probably null	Het
Cnr1	T	A	4: 33,944,728	M372K	possibly damaging	Het
Col6a3	T	C	1: 90,779,152	T2080A	unknown	Het
Crybg3	A	T	16: 59,544,138	C2374S	probably benign	Het
Csmd2	A	G	4: 128,563,371	I3544V	probably damaging	Het
Dnah12	A	T	14: 26,796,223	D1809V	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dnajb12	A	G	10: 59,892,780	D190G	possibly damaging	Het
Dtnb	T	A	12: 3,686,817	V319D	probably damaging	Het
Ercc6	A	T	14: 32,566,331	E820V	probably benign	Het
Fip1l1	T	G	5: 74,591,774	V378G	probably damaging	Het
Gabrg1	T	A	5: 70,754,209	Y358F	possibly damaging	Het
Gcn1l1	T	G	5: 115,609,158		probably null	Het
Gm11011	T	A	2: 169,587,482	T28S	unknown	Het
Gm13762	T	G	2: 88,973,268	I208L	probably benign	Het
Gm14025	A	C	2: 129,038,056	V650G	probably benign	Het
Gm4027	A	T	12: 87,621,984	I129F	unknown	Het
Guf1	C	A	5: 69,566,393	N438K	probably damaging	Het
Hoxa7	T	C	6: 52,215,739	E223G	probably benign	Het
Hspg2	G	A	4: 137,515,307	G611E	probably damaging	Het
Ipo8	A	T	6: 148,809,975		probably null	Het
Isl2	A	G	9: 55,541,288	D3G	possibly damaging	Het
Kcnb2	A	G	1: 15,710,440	Y512C	probably damaging	Het
Kifc1	T	A	17: 33,886,733		probably null	Het
Klhdc10	A	G	6: 30,446,641	D183G	probably damaging	Het
Klra5	T	A	6: 129,906,680	K71N	probably benign	Het
Lrp6	T	C	6: 134,486,541	H559R	possibly damaging	Het
Maml3	T	C	3: 51,855,875	N556S	probably damaging	Het
Man2a1	A	G	17: 64,731,269	I83V	possibly damaging	Het
Mrgpra9	A	G	7: 47,235,038	S293P	probably damaging	Het
Nalcn	A	G	14: 123,298,067	S1282P	probably damaging	Het
Npepps	A	T	11: 97,206,002		probably benign	Het
Olfr1037	A	T	2: 86,085,357	V140E	possibly damaging	Het
Olfr1154	T	G	2: 87,903,602	S25R	probably benign	Het
Olfr1245	A	T	2: 89,574,965	F254I	probably benign	Het
Pkn3	C	A	2: 30,090,550	R818S	possibly damaging	Het
Plekha3	T	A	2: 76,687,401	H190Q	probably damaging	Het
Ppp2r3c	A	T	12: 55,288,496	S261T	probably benign	Het
Pus10	T	C	11: 23,729,037	M503T	possibly damaging	Het
Pvr	T	C	7: 19,918,679	R104G	possibly damaging	Het
Rubcnl	A	G	14: 75,052,010	R653G	probably benign	Het
Serpina1a	G	T	12: 103,860,420		probably benign	Het
Shank3	G	A	15: 89,532,453	R265Q	probably damaging	Het
Slc22a22	C	T	15: 57,247,532	R433H	probably damaging	Het
Slc22a26	A	G	19: 7,802,361	I30T	probably benign	Het
Spz1	A	T	13: 92,575,484	N161K	possibly damaging	Het
Tacc2	A	G	7: 130,728,762	R259G	probably damaging	Het
Top1	G	A	2: 160,712,696	V456M	probably damaging	Het
Tpcn2	G	A	7: 145,256,520	A649V	probably benign	Het
Trank1	C	G	9: 111,365,916	R1003G	probably damaging	Het
Tril	T	A	6: 53,819,574	H221L	possibly damaging	Het
Unc79	C	T	12: 103,104,861	T1305I	probably damaging	Het
Unc80	C	T	1: 66,683,191	A2988V	possibly damaging	Het
Vmn1r81	A	T	7: 12,260,672	M3K	probably damaging	Het
Vmn2r78	A	T	7: 86,954,258	D548V	probably damaging	Het
Vwa3b	G	A	1: 37,045,031	R95Q	probably damaging	Het
Wdr6	G	A	9: 108,574,894	H597Y	probably benign	Het
Yme1l1	C	T	2: 23,194,762	T624I	probably damaging	Het

Other mutations in Ptprj

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01528:Ptprj	APN	2	90452144	missense	probably damaging	1.00
IGL01594:Ptprj	APN	2	90440795	splice site	probably benign
IGL01767:Ptprj	APN	2	90469574	missense	probably benign	0.11
IGL01917:Ptprj	APN	2	90469749	missense	probably damaging	1.00
IGL01981:Ptprj	APN	2	90439912	missense	probably damaging	1.00
IGL02830:Ptprj	APN	2	90453144	missense	probably benign	0.22
IGL02955:Ptprj	APN	2	90468464	critical splice acceptor site	probably null
IGL03102:Ptprj	APN	2	90478968	missense	probably benign	0.02
IGL03150:Ptprj	APN	2	90460611	missense	probably damaging	0.98
IGL03210:Ptprj	APN	2	90469726	missense	probably benign	0.01
IGL02799:Ptprj	UTSW	2	90469598	missense	probably benign	0.00
R0083:Ptprj	UTSW	2	90469777	splice site	probably null
R0108:Ptprj	UTSW	2	90469777	splice site	probably null
R0579:Ptprj	UTSW	2	90436569	critical splice acceptor site	probably null
R1130:Ptprj	UTSW	2	90453421	missense	probably damaging	1.00
R1160:Ptprj	UTSW	2	90444524	missense	probably damaging	1.00
R1238:Ptprj	UTSW	2	90444414	splice site	probably null
R1507:Ptprj	UTSW	2	90471287	missense	possibly damaging	0.87
R1552:Ptprj	UTSW	2	90471153	missense	probably damaging	0.98
R1607:Ptprj	UTSW	2	90463320	missense	probably benign	0.14
R1693:Ptprj	UTSW	2	90449797	nonsense	probably null
R2016:Ptprj	UTSW	2	90464614	missense	probably damaging	1.00
R2017:Ptprj	UTSW	2	90464614	missense	probably damaging	1.00
R2044:Ptprj	UTSW	2	90463095	missense	probably damaging	0.96
R2322:Ptprj	UTSW	2	90471129	missense	probably benign	0.06
R2516:Ptprj	UTSW	2	90474996	splice site	probably benign
R3106:Ptprj	UTSW	2	90440631	missense	probably damaging	1.00
R3964:Ptprj	UTSW	2	90468441	missense	probably benign	0.00
R4201:Ptprj	UTSW	2	90463095	missense	probably damaging	0.99
R4533:Ptprj	UTSW	2	90439955	missense	probably damaging	1.00
R4680:Ptprj	UTSW	2	90460496	missense	probably benign	0.00
R4738:Ptprj	UTSW	2	90440643	missense	probably damaging	1.00
R4983:Ptprj	UTSW	2	90460532	missense	probably damaging	0.98
R5137:Ptprj	UTSW	2	90469648	missense	possibly damaging	0.70
R5349:Ptprj	UTSW	2	90471261	missense	probably benign	0.00
R5369:Ptprj	UTSW	2	90469641	missense	probably benign	0.09
R5718:Ptprj	UTSW	2	90458269	missense	probably benign	0.00
R5914:Ptprj	UTSW	2	90453340	missense	possibly damaging	0.81
R6022:Ptprj	UTSW	2	90471323	missense	probably benign	0.14
R6341:Ptprj	UTSW	2	90458349	missense	probably benign
R6421:Ptprj	UTSW	2	90471140	missense	possibly damaging	0.62
R6831:Ptprj	UTSW	2	90460647	missense	probably damaging	1.00
R6939:Ptprj	UTSW	2	90459514	missense	possibly damaging	0.68
R6972:Ptprj	UTSW	2	90580403	missense	possibly damaging	0.91
R7134:Ptprj	UTSW	2	90464478	missense	probably benign	0.16
R7149:Ptprj	UTSW	2	90444446	missense	possibly damaging	0.95
R7243:Ptprj	UTSW	2	90446421	missense	probably damaging	0.96
R7335:Ptprj	UTSW	2	90440782	missense	probably benign	0.01
R7439:Ptprj	UTSW	2	90449819	missense	possibly damaging	0.82
R7441:Ptprj	UTSW	2	90449819	missense	possibly damaging	0.82
R7498:Ptprj	UTSW	2	90436565	nonsense	probably null
R7571:Ptprj	UTSW	2	90455186	missense	probably benign	0.24
R7657:Ptprj	UTSW	2	90452157	splice site	probably null
R7672:Ptprj	UTSW	2	90460596	missense	possibly damaging	0.49
R7849:Ptprj	UTSW	2	90444460	missense	probably damaging	0.98
R7939:Ptprj	UTSW	2	90464665	missense	probably damaging	1.00
R7958:Ptprj	UTSW	2	90469627	missense	possibly damaging	0.71
R8338:Ptprj	UTSW	2	90471137	missense	possibly damaging	0.48
R8354:Ptprj	UTSW	2	90469717	missense	probably benign	0.43
R8556:Ptprj	UTSW	2	90440700	missense	probably damaging	1.00
R8695:Ptprj	UTSW	2	90471137	missense	possibly damaging	0.48
R8784:Ptprj	UTSW	2	90460512	missense	possibly damaging	0.49
R8984:Ptprj	UTSW	2	90440643	missense	probably damaging	1.00
R9054:Ptprj	UTSW	2	90460640	missense	probably damaging	1.00
R9056:Ptprj	UTSW	2	90458269	missense	probably benign	0.00
R9147:Ptprj	UTSW	2	90458218	missense	probably benign	0.02
R9148:Ptprj	UTSW	2	90458218	missense	probably benign	0.02
R9168:Ptprj	UTSW	2	90464572	missense	possibly damaging	0.62
R9314:Ptprj	UTSW	2	90471287	missense	possibly damaging	0.87
R9337:Ptprj	UTSW	2	90439894	missense	probably damaging	1.00
R9546:Ptprj	UTSW	2	90444461	missense	probably benign	0.08
RF013:Ptprj	UTSW	2	90471170	nonsense	probably null
Z1177:Ptprj	UTSW	2	90460569	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAACTTCCATATGACTGTGGC -3'
(R):5'- AGTTTGCAGATAGTTTGCATGTCC -3'

Sequencing Primer
(F):5'- TGGCCAATCTGTCAATCAGG -3'
(R):5'- CTGTGAAGAGAGGTGTCT -3'

Posted On

2018-08-01