Mutagenetix > Incidental Mutation

Incidental Mutation 'R6724:Cnr1'

529746

Institutional Source

Beutler Lab

Gene Symbol

Cnr1

Ensembl Gene

ENSMUSG00000044288

Gene Name

cannabinoid receptor 1 (brain)

Synonyms

CB1R, CB1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R6724 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33924593-33948831 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 33944728 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 372 (M372K)

Ref Sequence

ENSEMBL: ENSMUSP00000081787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057188] [ENSMUST00000084736]

AlphaFold

P47746

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057188
AA Change: M372K

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000055797
Gene: ENSMUSG00000044288
AA Change: M372K

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	125	319	1.4e-7	PFAM
Pfam:7TM_GPCR_Srv	126	415	1.1e-8	PFAM
Pfam:7TM_GPCR_Srsx	127	413	1.4e-14	PFAM
Pfam:7tm_1	134	398	2.4e-45	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084736
AA Change: M372K

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000081787
Gene: ENSMUSG00000044288
AA Change: M372K

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	125	319	1.9e-7	PFAM
Pfam:7TM_GPCR_Srv	126	415	1.3e-8	PFAM
Pfam:7TM_GPCR_Srsx	127	413	1.4e-14	PFAM
Pfam:7tm_1	134	398	2.2e-52	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two cannabinoid receptors. The cannabinoids, principally delta-9-tetrahydrocannabinol and synthetic analogs, are psychoactive ingredients of marijuana. The cannabinoid receptors are members of the guanine-nucleotide-binding protein (G-protein) coupled receptor family, which inhibit adenylate cyclase activity in a dose-dependent, stereoselective and pertussis toxin-sensitive manner. The two receptors have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. Multiple transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors, altered long term depression and susceptibility to induced seizure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts5	T	A	16: 85,868,557	T619S	probably benign	Het
Adgra2	G	A	8: 27,114,182	A467T	possibly damaging	Het
AF366264	A	T	8: 13,837,083	L336Q	probably damaging	Het
Alox5	A	T	6: 116,414,548	I416N	probably damaging	Het
Blmh	A	G	11: 76,971,907		probably null	Het
Cftr	T	A	6: 18,255,974	Y567*	probably null	Het
Col6a3	T	C	1: 90,779,152	T2080A	unknown	Het
Crybg3	A	T	16: 59,544,138	C2374S	probably benign	Het
Csmd2	A	G	4: 128,563,371	I3544V	probably damaging	Het
Dnah12	A	T	14: 26,796,223	D1809V	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dnajb12	A	G	10: 59,892,780	D190G	possibly damaging	Het
Dtnb	T	A	12: 3,686,817	V319D	probably damaging	Het
Ercc6	A	T	14: 32,566,331	E820V	probably benign	Het
Fip1l1	T	G	5: 74,591,774	V378G	probably damaging	Het
Gabrg1	T	A	5: 70,754,209	Y358F	possibly damaging	Het
Gcn1l1	T	G	5: 115,609,158		probably null	Het
Gm11011	T	A	2: 169,587,482	T28S	unknown	Het
Gm13762	T	G	2: 88,973,268	I208L	probably benign	Het
Gm14025	A	C	2: 129,038,056	V650G	probably benign	Het
Gm4027	A	T	12: 87,621,984	I129F	unknown	Het
Guf1	C	A	5: 69,566,393	N438K	probably damaging	Het
Hoxa7	T	C	6: 52,215,739	E223G	probably benign	Het
Hspg2	G	A	4: 137,515,307	G611E	probably damaging	Het
Ipo8	A	T	6: 148,809,975		probably null	Het
Isl2	A	G	9: 55,541,288	D3G	possibly damaging	Het
Kcnb2	A	G	1: 15,710,440	Y512C	probably damaging	Het
Kifc1	T	A	17: 33,886,733		probably null	Het
Klhdc10	A	G	6: 30,446,641	D183G	probably damaging	Het
Klra5	T	A	6: 129,906,680	K71N	probably benign	Het
Lrp6	T	C	6: 134,486,541	H559R	possibly damaging	Het
Maml3	T	C	3: 51,855,875	N556S	probably damaging	Het
Man2a1	A	G	17: 64,731,269	I83V	possibly damaging	Het
Mrgpra9	A	G	7: 47,235,038	S293P	probably damaging	Het
Nalcn	A	G	14: 123,298,067	S1282P	probably damaging	Het
Npepps	A	T	11: 97,206,002		probably benign	Het
Olfr1037	A	T	2: 86,085,357	V140E	possibly damaging	Het
Olfr1154	T	G	2: 87,903,602	S25R	probably benign	Het
Olfr1245	A	T	2: 89,574,965	F254I	probably benign	Het
Pkn3	C	A	2: 30,090,550	R818S	possibly damaging	Het
Plekha3	T	A	2: 76,687,401	H190Q	probably damaging	Het
Ppp2r3c	A	T	12: 55,288,496	S261T	probably benign	Het
Ptprj	T	C	2: 90,450,851	D1015G	probably benign	Het
Pus10	T	C	11: 23,729,037	M503T	possibly damaging	Het
Pvr	T	C	7: 19,918,679	R104G	possibly damaging	Het
Rubcnl	A	G	14: 75,052,010	R653G	probably benign	Het
Serpina1a	G	T	12: 103,860,420		probably benign	Het
Shank3	G	A	15: 89,532,453	R265Q	probably damaging	Het
Slc22a22	C	T	15: 57,247,532	R433H	probably damaging	Het
Slc22a26	A	G	19: 7,802,361	I30T	probably benign	Het
Spz1	A	T	13: 92,575,484	N161K	possibly damaging	Het
Tacc2	A	G	7: 130,728,762	R259G	probably damaging	Het
Top1	G	A	2: 160,712,696	V456M	probably damaging	Het
Tpcn2	G	A	7: 145,256,520	A649V	probably benign	Het
Trank1	C	G	9: 111,365,916	R1003G	probably damaging	Het
Tril	T	A	6: 53,819,574	H221L	possibly damaging	Het
Unc79	C	T	12: 103,104,861	T1305I	probably damaging	Het
Unc80	C	T	1: 66,683,191	A2988V	possibly damaging	Het
Vmn1r81	A	T	7: 12,260,672	M3K	probably damaging	Het
Vmn2r78	A	T	7: 86,954,258	D548V	probably damaging	Het
Vwa3b	G	A	1: 37,045,031	R95Q	probably damaging	Het
Wdr6	G	A	9: 108,574,894	H597Y	probably benign	Het
Yme1l1	C	T	2: 23,194,762	T624I	probably damaging	Het

Other mutations in Cnr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Cnr1	APN	4	33944116	missense	probably damaging	1.00
IGL01408:Cnr1	APN	4	33944802	missense	possibly damaging	0.88
IGL02551:Cnr1	APN	4	33943686	missense	probably benign
Attentive	UTSW	4	33944038	missense	probably damaging	0.99
Madness	UTSW	4	33944330	nonsense	probably null
sober	UTSW	4	33944416	missense	probably damaging	1.00
R1730:Cnr1	UTSW	4	33943851	missense	possibly damaging	0.52
R1758:Cnr1	UTSW	4	33945000	missense	probably damaging	1.00
R2322:Cnr1	UTSW	4	33944514	missense	probably damaging	1.00
R4688:Cnr1	UTSW	4	33944571	missense	probably benign	0.38
R5289:Cnr1	UTSW	4	33943910	nonsense	probably null
R5707:Cnr1	UTSW	4	33944330	nonsense	probably null
R6042:Cnr1	UTSW	4	33944751	missense	probably damaging	1.00
R6630:Cnr1	UTSW	4	33944659	missense	probably damaging	1.00
R6916:Cnr1	UTSW	4	33943897	missense	probably benign
R6987:Cnr1	UTSW	4	33944739	missense	probably benign	0.00
R7410:Cnr1	UTSW	4	33944119	missense	probably damaging	1.00
R7721:Cnr1	UTSW	4	33944416	missense	probably damaging	1.00
R7723:Cnr1	UTSW	4	33944416	missense	probably damaging	1.00
R7769:Cnr1	UTSW	4	33944892	missense	probably benign
R8062:Cnr1	UTSW	4	33944707	missense	possibly damaging	0.95
R8701:Cnr1	UTSW	4	33944739	missense	probably benign	0.00
R9362:Cnr1	UTSW	4	33944038	missense	probably damaging	0.99
R9365:Cnr1	UTSW	4	33943798	missense	probably benign	0.06
R9410:Cnr1	UTSW	4	33944973	missense	possibly damaging	0.75
R9590:Cnr1	UTSW	4	33944849	missense	probably benign
U24488:Cnr1	UTSW	4	33944927	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CATTCTCTGGAAGGCTCACAGC -3'
(R):5'- TTGTGCAGGCAGTCTGAGTC -3'

Sequencing Primer
(F):5'- AGTTCGCATGATCCAGCGTG -3'
(R):5'- GAGTCCCCCATGCTGTTATCTAGAG -3'

Posted On

2018-08-01