Incidental Mutation 'R6724:Csmd2'
ID529747
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6724 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128563371 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 3544 (I3544V)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000184063
AA Change: I3544V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect unknown
Transcript: ENSMUST00000221199
AA Change: I234V
Meta Mutation Damage Score 0.0876 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 T A 16: 85,868,557 T619S probably benign Het
Adgra2 G A 8: 27,114,182 A467T possibly damaging Het
AF366264 A T 8: 13,837,083 L336Q probably damaging Het
Alox5 A T 6: 116,414,548 I416N probably damaging Het
Blmh A G 11: 76,971,907 probably null Het
Cftr T A 6: 18,255,974 Y567* probably null Het
Cnr1 T A 4: 33,944,728 M372K possibly damaging Het
Col6a3 T C 1: 90,779,152 T2080A unknown Het
Crybg3 A T 16: 59,544,138 C2374S probably benign Het
Dnah12 A T 14: 26,796,223 D1809V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajb12 A G 10: 59,892,780 D190G possibly damaging Het
Dtnb T A 12: 3,686,817 V319D probably damaging Het
Ercc6 A T 14: 32,566,331 E820V probably benign Het
Fip1l1 T G 5: 74,591,774 V378G probably damaging Het
Gabrg1 T A 5: 70,754,209 Y358F possibly damaging Het
Gcn1l1 T G 5: 115,609,158 probably null Het
Gm11011 T A 2: 169,587,482 T28S unknown Het
Gm13762 T G 2: 88,973,268 I208L probably benign Het
Gm14025 A C 2: 129,038,056 V650G probably benign Het
Gm4027 A T 12: 87,621,984 I129F unknown Het
Guf1 C A 5: 69,566,393 N438K probably damaging Het
Hoxa7 T C 6: 52,215,739 E223G probably benign Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ipo8 A T 6: 148,809,975 probably null Het
Isl2 A G 9: 55,541,288 D3G possibly damaging Het
Kcnb2 A G 1: 15,710,440 Y512C probably damaging Het
Kifc1 T A 17: 33,886,733 probably null Het
Klhdc10 A G 6: 30,446,641 D183G probably damaging Het
Klra5 T A 6: 129,906,680 K71N probably benign Het
Lrp6 T C 6: 134,486,541 H559R possibly damaging Het
Maml3 T C 3: 51,855,875 N556S probably damaging Het
Man2a1 A G 17: 64,731,269 I83V possibly damaging Het
Mrgpra9 A G 7: 47,235,038 S293P probably damaging Het
Nalcn A G 14: 123,298,067 S1282P probably damaging Het
Npepps A T 11: 97,206,002 probably benign Het
Olfr1037 A T 2: 86,085,357 V140E possibly damaging Het
Olfr1154 T G 2: 87,903,602 S25R probably benign Het
Olfr1245 A T 2: 89,574,965 F254I probably benign Het
Pkn3 C A 2: 30,090,550 R818S possibly damaging Het
Plekha3 T A 2: 76,687,401 H190Q probably damaging Het
Ppp2r3c A T 12: 55,288,496 S261T probably benign Het
Ptprj T C 2: 90,450,851 D1015G probably benign Het
Pus10 T C 11: 23,729,037 M503T possibly damaging Het
Pvr T C 7: 19,918,679 R104G possibly damaging Het
Rubcnl A G 14: 75,052,010 R653G probably benign Het
Serpina1a G T 12: 103,860,420 probably benign Het
Shank3 G A 15: 89,532,453 R265Q probably damaging Het
Slc22a22 C T 15: 57,247,532 R433H probably damaging Het
Slc22a26 A G 19: 7,802,361 I30T probably benign Het
Spz1 A T 13: 92,575,484 N161K possibly damaging Het
Tacc2 A G 7: 130,728,762 R259G probably damaging Het
Top1 G A 2: 160,712,696 V456M probably damaging Het
Tpcn2 G A 7: 145,256,520 A649V probably benign Het
Trank1 C G 9: 111,365,916 R1003G probably damaging Het
Tril T A 6: 53,819,574 H221L possibly damaging Het
Unc79 C T 12: 103,104,861 T1305I probably damaging Het
Unc80 C T 1: 66,683,191 A2988V possibly damaging Het
Vmn1r81 A T 7: 12,260,672 M3K probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Vwa3b G A 1: 37,045,031 R95Q probably damaging Het
Wdr6 G A 9: 108,574,894 H597Y probably benign Het
Yme1l1 C T 2: 23,194,762 T624I probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 intron probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- CAAGAGCAGGTGACAGTACC -3'
(R):5'- GGGTATACAGTTGTTCTCCCTG -3'

Sequencing Primer
(F):5'- TGACAGTACCTGCCGCTCTG -3'
(R):5'- CCCTCAGGGTACTAGGTCTG -3'
Posted On2018-08-01