Incidental Mutation 'R6724:Gcn1l1'
ID529752
Institutional Source Beutler Lab
Gene Symbol Gcn1l1
Ensembl Gene ENSMUSG00000041638
Gene NameGCN1 general control of amino-acid synthesis 1-like 1 (yeast)
SynonymsGCN1L, G431004K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R6724 (G1)
Quality Score185.009
Status Validated
Chromosome5
Chromosomal Location115565254-115622654 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 115609158 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
Predicted Effect probably null
Transcript: ENSMUST00000064454
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094427
SMART Domains Protein: ENSMUSP00000091994
Gene: ENSMUSG00000041638

DomainStartEndE-ValueType
Pfam:HEAT 42 72 5.8e-5 PFAM
low complexity region 310 318 N/A INTRINSIC
Pfam:HEAT_EZ 326 374 2.2e-5 PFAM
Blast:EZ_HEAT 403 439 1e-15 BLAST
Pfam:HEAT_EZ 703 757 1.3e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139933
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 T A 16: 85,868,557 T619S probably benign Het
Adgra2 G A 8: 27,114,182 A467T possibly damaging Het
AF366264 A T 8: 13,837,083 L336Q probably damaging Het
Alox5 A T 6: 116,414,548 I416N probably damaging Het
Blmh A G 11: 76,971,907 probably null Het
Cftr T A 6: 18,255,974 Y567* probably null Het
Cnr1 T A 4: 33,944,728 M372K possibly damaging Het
Col6a3 T C 1: 90,779,152 T2080A unknown Het
Crybg3 A T 16: 59,544,138 C2374S probably benign Het
Csmd2 A G 4: 128,563,371 I3544V probably damaging Het
Dnah12 A T 14: 26,796,223 D1809V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajb12 A G 10: 59,892,780 D190G possibly damaging Het
Dtnb T A 12: 3,686,817 V319D probably damaging Het
Ercc6 A T 14: 32,566,331 E820V probably benign Het
Fip1l1 T G 5: 74,591,774 V378G probably damaging Het
Gabrg1 T A 5: 70,754,209 Y358F possibly damaging Het
Gm11011 T A 2: 169,587,482 T28S unknown Het
Gm13762 T G 2: 88,973,268 I208L probably benign Het
Gm14025 A C 2: 129,038,056 V650G probably benign Het
Gm4027 A T 12: 87,621,984 I129F unknown Het
Guf1 C A 5: 69,566,393 N438K probably damaging Het
Hoxa7 T C 6: 52,215,739 E223G probably benign Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ipo8 A T 6: 148,809,975 probably null Het
Isl2 A G 9: 55,541,288 D3G possibly damaging Het
Kcnb2 A G 1: 15,710,440 Y512C probably damaging Het
Kifc1 T A 17: 33,886,733 probably null Het
Klhdc10 A G 6: 30,446,641 D183G probably damaging Het
Klra5 T A 6: 129,906,680 K71N probably benign Het
Lrp6 T C 6: 134,486,541 H559R possibly damaging Het
Maml3 T C 3: 51,855,875 N556S probably damaging Het
Man2a1 A G 17: 64,731,269 I83V possibly damaging Het
Mrgpra9 A G 7: 47,235,038 S293P probably damaging Het
Nalcn A G 14: 123,298,067 S1282P probably damaging Het
Npepps A T 11: 97,206,002 probably benign Het
Olfr1037 A T 2: 86,085,357 V140E possibly damaging Het
Olfr1154 T G 2: 87,903,602 S25R probably benign Het
Olfr1245 A T 2: 89,574,965 F254I probably benign Het
Pkn3 C A 2: 30,090,550 R818S possibly damaging Het
Plekha3 T A 2: 76,687,401 H190Q probably damaging Het
Ppp2r3c A T 12: 55,288,496 S261T probably benign Het
Ptprj T C 2: 90,450,851 D1015G probably benign Het
Pus10 T C 11: 23,729,037 M503T possibly damaging Het
Pvr T C 7: 19,918,679 R104G possibly damaging Het
Rubcnl A G 14: 75,052,010 R653G probably benign Het
Serpina1a G T 12: 103,860,420 probably benign Het
Shank3 G A 15: 89,532,453 R265Q probably damaging Het
Slc22a22 C T 15: 57,247,532 R433H probably damaging Het
Slc22a26 A G 19: 7,802,361 I30T probably benign Het
Spz1 A T 13: 92,575,484 N161K possibly damaging Het
Tacc2 A G 7: 130,728,762 R259G probably damaging Het
Top1 G A 2: 160,712,696 V456M probably damaging Het
Tpcn2 G A 7: 145,256,520 A649V probably benign Het
Trank1 C G 9: 111,365,916 R1003G probably damaging Het
Tril T A 6: 53,819,574 H221L possibly damaging Het
Unc79 C T 12: 103,104,861 T1305I probably damaging Het
Unc80 C T 1: 66,683,191 A2988V possibly damaging Het
Vmn1r81 A T 7: 12,260,672 M3K probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Vwa3b G A 1: 37,045,031 R95Q probably damaging Het
Wdr6 G A 9: 108,574,894 H597Y probably benign Het
Yme1l1 C T 2: 23,194,762 T624I probably damaging Het
Other mutations in Gcn1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1l1 APN 5 115588143 splice site probably benign
IGL00974:Gcn1l1 APN 5 115613793 missense possibly damaging 0.88
IGL01566:Gcn1l1 APN 5 115611058 missense probably damaging 1.00
IGL01843:Gcn1l1 APN 5 115619700 missense probably damaging 1.00
IGL01885:Gcn1l1 APN 5 115576115 splice site probably null
IGL02081:Gcn1l1 APN 5 115585871 missense probably damaging 1.00
IGL02118:Gcn1l1 APN 5 115610879 missense probably damaging 1.00
IGL02150:Gcn1l1 APN 5 115609868 missense probably damaging 1.00
IGL02190:Gcn1l1 APN 5 115614124 missense probably damaging 1.00
IGL02219:Gcn1l1 APN 5 115613767 missense possibly damaging 0.68
IGL02507:Gcn1l1 APN 5 115585881 missense probably benign 0.11
IGL02644:Gcn1l1 APN 5 115575191 missense probably benign
IGL02678:Gcn1l1 APN 5 115613755 missense probably damaging 0.99
IGL02748:Gcn1l1 APN 5 115610800 splice site probably null
IGL02755:Gcn1l1 APN 5 115604006 splice site probably null
IGL02896:Gcn1l1 APN 5 115619648 splice site probably benign
IGL03147:Gcn1l1 UTSW 5 115610858 missense possibly damaging 0.78
R0362:Gcn1l1 UTSW 5 115576108 splice site probably benign
R0540:Gcn1l1 UTSW 5 115588956 missense probably benign 0.00
R0569:Gcn1l1 UTSW 5 115595059 missense probably benign 0.00
R0570:Gcn1l1 UTSW 5 115592421 missense probably damaging 1.00
R0584:Gcn1l1 UTSW 5 115595015 missense probably damaging 1.00
R0630:Gcn1l1 UTSW 5 115581089 missense probably benign 0.06
R0656:Gcn1l1 UTSW 5 115589303 missense probably benign 0.27
R0801:Gcn1l1 UTSW 5 115591006 missense probably benign 0.12
R0890:Gcn1l1 UTSW 5 115579793 missense possibly damaging 0.77
R1400:Gcn1l1 UTSW 5 115614161 missense probably damaging 1.00
R1485:Gcn1l1 UTSW 5 115574617 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1673:Gcn1l1 UTSW 5 115582297 missense probably benign
R1894:Gcn1l1 UTSW 5 115589115 missense probably damaging 1.00
R2114:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2116:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2117:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2152:Gcn1l1 UTSW 5 115609829 missense probably benign 0.07
R2162:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R2216:Gcn1l1 UTSW 5 115593661 missense probably benign
R2218:Gcn1l1 UTSW 5 115619661 missense probably benign 0.04
R2278:Gcn1l1 UTSW 5 115611175 missense probably damaging 1.00
R2280:Gcn1l1 UTSW 5 115612730 missense probably damaging 1.00
R3719:Gcn1l1 UTSW 5 115579817 missense probably benign 0.03
R3729:Gcn1l1 UTSW 5 115583394 splice site probably benign
R3833:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R3932:Gcn1l1 UTSW 5 115587834 missense probably benign 0.11
R4067:Gcn1l1 UTSW 5 115599088 missense probably damaging 1.00
R4152:Gcn1l1 UTSW 5 115613354 critical splice acceptor site probably null
R4179:Gcn1l1 UTSW 5 115588050 missense probably benign 0.00
R4292:Gcn1l1 UTSW 5 115576148 missense possibly damaging 0.49
R4350:Gcn1l1 UTSW 5 115603330 missense probably damaging 1.00
R4493:Gcn1l1 UTSW 5 115594144 missense probably benign
R4672:Gcn1l1 UTSW 5 115606520 missense probably damaging 1.00
R4749:Gcn1l1 UTSW 5 115614402 missense probably benign
R4753:Gcn1l1 UTSW 5 115616478 missense probably benign
R4826:Gcn1l1 UTSW 5 115593693 missense probably benign
R4873:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4875:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4932:Gcn1l1 UTSW 5 115592144 missense probably benign 0.00
R4992:Gcn1l1 UTSW 5 115599166 missense probably benign 0.29
R5049:Gcn1l1 UTSW 5 115606671 missense probably damaging 1.00
R5211:Gcn1l1 UTSW 5 115619312 missense probably benign 0.04
R5226:Gcn1l1 UTSW 5 115588067 missense probably benign 0.01
R5338:Gcn1l1 UTSW 5 115583403 missense probably benign 0.00
R5914:Gcn1l1 UTSW 5 115610135 synonymous silent
R5932:Gcn1l1 UTSW 5 115592376 missense possibly damaging 0.77
R6422:Gcn1l1 UTSW 5 115609544 missense probably damaging 1.00
R6435:Gcn1l1 UTSW 5 115611022 critical splice acceptor site probably null
R6607:Gcn1l1 UTSW 5 115609478 missense probably damaging 0.98
R6861:Gcn1l1 UTSW 5 115611049 missense probably benign
R6875:Gcn1l1 UTSW 5 115588110 missense probably damaging 1.00
R6910:Gcn1l1 UTSW 5 115606538 missense probably benign 0.42
R6975:Gcn1l1 UTSW 5 115613459 missense probably damaging 1.00
R7027:Gcn1l1 UTSW 5 115616546 critical splice donor site probably null
R7038:Gcn1l1 UTSW 5 115611144 missense probably damaging 1.00
R7171:Gcn1l1 UTSW 5 115590293 missense probably benign 0.02
R7276:Gcn1l1 UTSW 5 115611060 missense probably damaging 1.00
R7456:Gcn1l1 UTSW 5 115604946 nonsense probably null
R7473:Gcn1l1 UTSW 5 115581804 missense probably benign 0.09
R7517:Gcn1l1 UTSW 5 115619696 missense probably benign 0.01
R7714:Gcn1l1 UTSW 5 115595300 missense probably damaging 0.97
R7752:Gcn1l1 UTSW 5 115615568 missense probably damaging 1.00
R7812:Gcn1l1 UTSW 5 115593692 missense possibly damaging 0.91
R8070:Gcn1l1 UTSW 5 115588998 missense probably benign 0.09
Z1177:Gcn1l1 UTSW 5 115614149 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGACAAGTTTGTGTGCCATG -3'
(R):5'- GCACTTTCCAGGAAGGTATTTTC -3'

Sequencing Primer
(F):5'- GACAAGTTTGTGTGCCATGATTTAC -3'
(R):5'- AGTGAAGCTTTCAGGCCA -3'
Posted On2018-08-01