Incidental Mutation 'R6724:Klra5'
ID529757
Institutional Source Beutler Lab
Gene Symbol Klra5
Ensembl Gene ENSMUSG00000030173
Gene Namekiller cell lectin-like receptor, subfamily A, member 5
SynonymsLy49e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6724 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location129898996-129917650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129906680 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 71 (K71N)
Ref Sequence ENSEMBL: ENSMUSP00000126290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014683] [ENSMUST00000118060] [ENSMUST00000169901]
Predicted Effect probably benign
Transcript: ENSMUST00000014683
AA Change: K161N

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000014683
Gene: ENSMUSG00000030173
AA Change: K161N

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 123 4e-9 BLAST
CLECT 143 258 3.66e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118060
AA Change: K161N

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112795
Gene: ENSMUSG00000030173
AA Change: K161N

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 123 4e-9 BLAST
CLECT 143 258 3.66e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167079
SMART Domains Protein: ENSMUSP00000125971
Gene: ENSMUSG00000030173

DomainStartEndE-ValueType
CLECT 53 168 3.66e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169901
AA Change: K71N

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126290
Gene: ENSMUSG00000030173
AA Change: K71N

DomainStartEndE-ValueType
CLECT 53 168 3.66e-18 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal NK and T cell morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 T A 16: 85,868,557 T619S probably benign Het
Adgra2 G A 8: 27,114,182 A467T possibly damaging Het
AF366264 A T 8: 13,837,083 L336Q probably damaging Het
Alox5 A T 6: 116,414,548 I416N probably damaging Het
Blmh A G 11: 76,971,907 probably null Het
Cftr T A 6: 18,255,974 Y567* probably null Het
Cnr1 T A 4: 33,944,728 M372K possibly damaging Het
Col6a3 T C 1: 90,779,152 T2080A unknown Het
Crybg3 A T 16: 59,544,138 C2374S probably benign Het
Csmd2 A G 4: 128,563,371 I3544V probably damaging Het
Dnah12 A T 14: 26,796,223 D1809V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajb12 A G 10: 59,892,780 D190G possibly damaging Het
Dtnb T A 12: 3,686,817 V319D probably damaging Het
Ercc6 A T 14: 32,566,331 E820V probably benign Het
Fip1l1 T G 5: 74,591,774 V378G probably damaging Het
Gabrg1 T A 5: 70,754,209 Y358F possibly damaging Het
Gcn1l1 T G 5: 115,609,158 probably null Het
Gm11011 T A 2: 169,587,482 T28S unknown Het
Gm13762 T G 2: 88,973,268 I208L probably benign Het
Gm14025 A C 2: 129,038,056 V650G probably benign Het
Gm4027 A T 12: 87,621,984 I129F unknown Het
Guf1 C A 5: 69,566,393 N438K probably damaging Het
Hoxa7 T C 6: 52,215,739 E223G probably benign Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ipo8 A T 6: 148,809,975 probably null Het
Isl2 A G 9: 55,541,288 D3G possibly damaging Het
Kcnb2 A G 1: 15,710,440 Y512C probably damaging Het
Kifc1 T A 17: 33,886,733 probably null Het
Klhdc10 A G 6: 30,446,641 D183G probably damaging Het
Lrp6 T C 6: 134,486,541 H559R possibly damaging Het
Maml3 T C 3: 51,855,875 N556S probably damaging Het
Man2a1 A G 17: 64,731,269 I83V possibly damaging Het
Mrgpra9 A G 7: 47,235,038 S293P probably damaging Het
Nalcn A G 14: 123,298,067 S1282P probably damaging Het
Npepps A T 11: 97,206,002 probably benign Het
Olfr1037 A T 2: 86,085,357 V140E possibly damaging Het
Olfr1154 T G 2: 87,903,602 S25R probably benign Het
Olfr1245 A T 2: 89,574,965 F254I probably benign Het
Pkn3 C A 2: 30,090,550 R818S possibly damaging Het
Plekha3 T A 2: 76,687,401 H190Q probably damaging Het
Ppp2r3c A T 12: 55,288,496 S261T probably benign Het
Ptprj T C 2: 90,450,851 D1015G probably benign Het
Pus10 T C 11: 23,729,037 M503T possibly damaging Het
Pvr T C 7: 19,918,679 R104G possibly damaging Het
Rubcnl A G 14: 75,052,010 R653G probably benign Het
Serpina1a G T 12: 103,860,420 probably benign Het
Shank3 G A 15: 89,532,453 R265Q probably damaging Het
Slc22a22 C T 15: 57,247,532 R433H probably damaging Het
Slc22a26 A G 19: 7,802,361 I30T probably benign Het
Spz1 A T 13: 92,575,484 N161K possibly damaging Het
Tacc2 A G 7: 130,728,762 R259G probably damaging Het
Top1 G A 2: 160,712,696 V456M probably damaging Het
Tpcn2 G A 7: 145,256,520 A649V probably benign Het
Trank1 C G 9: 111,365,916 R1003G probably damaging Het
Tril T A 6: 53,819,574 H221L possibly damaging Het
Unc79 C T 12: 103,104,861 T1305I probably damaging Het
Unc80 C T 1: 66,683,191 A2988V possibly damaging Het
Vmn1r81 A T 7: 12,260,672 M3K probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Vwa3b G A 1: 37,045,031 R95Q probably damaging Het
Wdr6 G A 9: 108,574,894 H597Y probably benign Het
Yme1l1 C T 2: 23,194,762 T624I probably damaging Het
Other mutations in Klra5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Klra5 APN 6 129911359 missense possibly damaging 0.63
IGL00972:Klra5 APN 6 129906605 missense probably damaging 1.00
IGL01770:Klra5 APN 6 129906664 missense probably damaging 1.00
IGL01978:Klra5 APN 6 129911430 missense probably benign 0.32
IGL01998:Klra5 APN 6 129906713 nonsense probably null
IGL02103:Klra5 APN 6 129911344 splice site probably null
IGL02995:Klra5 APN 6 129906614 missense possibly damaging 0.46
IGL03036:Klra5 APN 6 129908867 missense probably damaging 0.99
R0314:Klra5 UTSW 6 129903590 missense probably damaging 1.00
R0378:Klra5 UTSW 6 129906614 missense possibly damaging 0.46
R0646:Klra5 UTSW 6 129903564 missense probably damaging 1.00
R0731:Klra5 UTSW 6 129908796 missense possibly damaging 0.88
R1552:Klra5 UTSW 6 129909885 missense probably damaging 0.97
R1572:Klra5 UTSW 6 129906622 missense probably damaging 1.00
R1807:Klra5 UTSW 6 129899420 missense probably benign 0.00
R4451:Klra5 UTSW 6 129908834 nonsense probably null
R4619:Klra5 UTSW 6 129908813 missense probably benign 0.05
R4647:Klra5 UTSW 6 129899376 missense probably damaging 0.99
R5019:Klra5 UTSW 6 129899389 missense probably benign
R5364:Klra5 UTSW 6 129899353 missense probably benign
R6925:Klra5 UTSW 6 129911457 missense probably benign 0.41
R7834:Klra5 UTSW 6 129899290 critical splice donor site probably null
R7917:Klra5 UTSW 6 129899290 critical splice donor site probably null
Z1176:Klra5 UTSW 6 129911452 missense not run
Predicted Primers PCR Primer
(F):5'- ACTTAACAGACTTGTGTCCCACAG -3'
(R):5'- TCTGAGACCTATGAGATTTTACCTC -3'

Sequencing Primer
(F):5'- ACAGACTTGTGTCCCACAGTTATG -3'
(R):5'- CCTTCTCTGTTGTAGGGA -3'
Posted On2018-08-01