Incidental Mutation 'R6724:Tpcn2'
ID529765
Institutional Source Beutler Lab
Gene Symbol Tpcn2
Ensembl Gene ENSMUSG00000048677
Gene Nametwo pore segment channel 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6724 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location145186524-145284011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 145256520 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 649 (A649V)
Ref Sequence ENSEMBL: ENSMUSP00000061308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058022] [ENSMUST00000208148] [ENSMUST00000208328] [ENSMUST00000208841] [ENSMUST00000209047]
Predicted Effect probably benign
Transcript: ENSMUST00000058022
AA Change: A649V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000061308
Gene: ENSMUSG00000048677
AA Change: A649V

DomainStartEndE-ValueType
Pfam:Ion_trans 67 302 5.1e-24 PFAM
Pfam:Ion_trans 415 683 1.5e-29 PFAM
low complexity region 709 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208148
Predicted Effect probably benign
Transcript: ENSMUST00000208328
Predicted Effect probably benign
Transcript: ENSMUST00000208841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208867
Predicted Effect probably benign
Transcript: ENSMUST00000209047
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative cation-selective ion channel with two repeats of a six-transmembrane-domain. The protein localizes to lysosomal membranes and enables nicotinic acid adenine dinucleotide phosphate (NAADP) -induced calcium ion release from lysosome-related stores. This ubiquitously expressed gene has elevated expression in liver and kidney. Two common nonsynonymous SNPs in this gene strongly associate with blond versus brown hair pigmentation.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit altered beta cell calcium ion physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 T A 16: 85,868,557 T619S probably benign Het
Adgra2 G A 8: 27,114,182 A467T possibly damaging Het
AF366264 A T 8: 13,837,083 L336Q probably damaging Het
Alox5 A T 6: 116,414,548 I416N probably damaging Het
Blmh A G 11: 76,971,907 probably null Het
Cftr T A 6: 18,255,974 Y567* probably null Het
Cnr1 T A 4: 33,944,728 M372K possibly damaging Het
Col6a3 T C 1: 90,779,152 T2080A unknown Het
Crybg3 A T 16: 59,544,138 C2374S probably benign Het
Csmd2 A G 4: 128,563,371 I3544V probably damaging Het
Dnah12 A T 14: 26,796,223 D1809V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajb12 A G 10: 59,892,780 D190G possibly damaging Het
Dtnb T A 12: 3,686,817 V319D probably damaging Het
Ercc6 A T 14: 32,566,331 E820V probably benign Het
Fip1l1 T G 5: 74,591,774 V378G probably damaging Het
Gabrg1 T A 5: 70,754,209 Y358F possibly damaging Het
Gcn1l1 T G 5: 115,609,158 probably null Het
Gm11011 T A 2: 169,587,482 T28S unknown Het
Gm13762 T G 2: 88,973,268 I208L probably benign Het
Gm14025 A C 2: 129,038,056 V650G probably benign Het
Gm4027 A T 12: 87,621,984 I129F unknown Het
Guf1 C A 5: 69,566,393 N438K probably damaging Het
Hoxa7 T C 6: 52,215,739 E223G probably benign Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ipo8 A T 6: 148,809,975 probably null Het
Isl2 A G 9: 55,541,288 D3G possibly damaging Het
Kcnb2 A G 1: 15,710,440 Y512C probably damaging Het
Kifc1 T A 17: 33,886,733 probably null Het
Klhdc10 A G 6: 30,446,641 D183G probably damaging Het
Klra5 T A 6: 129,906,680 K71N probably benign Het
Lrp6 T C 6: 134,486,541 H559R possibly damaging Het
Maml3 T C 3: 51,855,875 N556S probably damaging Het
Man2a1 A G 17: 64,731,269 I83V possibly damaging Het
Mrgpra9 A G 7: 47,235,038 S293P probably damaging Het
Nalcn A G 14: 123,298,067 S1282P probably damaging Het
Npepps A T 11: 97,206,002 probably benign Het
Olfr1037 A T 2: 86,085,357 V140E possibly damaging Het
Olfr1154 T G 2: 87,903,602 S25R probably benign Het
Olfr1245 A T 2: 89,574,965 F254I probably benign Het
Pkn3 C A 2: 30,090,550 R818S possibly damaging Het
Plekha3 T A 2: 76,687,401 H190Q probably damaging Het
Ppp2r3c A T 12: 55,288,496 S261T probably benign Het
Ptprj T C 2: 90,450,851 D1015G probably benign Het
Pus10 T C 11: 23,729,037 M503T possibly damaging Het
Pvr T C 7: 19,918,679 R104G possibly damaging Het
Rubcnl A G 14: 75,052,010 R653G probably benign Het
Serpina1a G T 12: 103,860,420 probably benign Het
Shank3 G A 15: 89,532,453 R265Q probably damaging Het
Slc22a22 C T 15: 57,247,532 R433H probably damaging Het
Slc22a26 A G 19: 7,802,361 I30T probably benign Het
Spz1 A T 13: 92,575,484 N161K possibly damaging Het
Tacc2 A G 7: 130,728,762 R259G probably damaging Het
Top1 G A 2: 160,712,696 V456M probably damaging Het
Trank1 C G 9: 111,365,916 R1003G probably damaging Het
Tril T A 6: 53,819,574 H221L possibly damaging Het
Unc79 C T 12: 103,104,861 T1305I probably damaging Het
Unc80 C T 1: 66,683,191 A2988V possibly damaging Het
Vmn1r81 A T 7: 12,260,672 M3K probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Vwa3b G A 1: 37,045,031 R95Q probably damaging Het
Wdr6 G A 9: 108,574,894 H597Y probably benign Het
Yme1l1 C T 2: 23,194,762 T624I probably damaging Het
Other mutations in Tpcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Tpcn2 APN 7 145267378 missense probably damaging 1.00
IGL02112:Tpcn2 APN 7 145256792 missense probably benign 0.18
IGL02646:Tpcn2 APN 7 145258574 missense probably benign 0.03
R0385:Tpcn2 UTSW 7 145277174 missense probably damaging 1.00
R1441:Tpcn2 UTSW 7 145260134 missense probably benign
R1498:Tpcn2 UTSW 7 145268911 missense probably damaging 1.00
R1598:Tpcn2 UTSW 7 145277220 nonsense probably null
R2127:Tpcn2 UTSW 7 145273975 splice site probably benign
R2354:Tpcn2 UTSW 7 145257218 missense probably damaging 1.00
R3747:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R3748:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R3749:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R4775:Tpcn2 UTSW 7 145267342 missense probably damaging 1.00
R4835:Tpcn2 UTSW 7 145272351 missense probably damaging 0.98
R4931:Tpcn2 UTSW 7 145267309 missense probably benign 0.34
R4979:Tpcn2 UTSW 7 145260096 missense probably benign
R5185:Tpcn2 UTSW 7 145255454 missense probably damaging 1.00
R5418:Tpcn2 UTSW 7 145278781 missense probably damaging 1.00
R5443:Tpcn2 UTSW 7 145255472 missense possibly damaging 0.46
R5623:Tpcn2 UTSW 7 145267334 missense possibly damaging 0.76
R5716:Tpcn2 UTSW 7 145257813 missense possibly damaging 0.94
R5910:Tpcn2 UTSW 7 145260982 missense probably benign 0.01
R5927:Tpcn2 UTSW 7 145278784 missense probably damaging 0.99
R6015:Tpcn2 UTSW 7 145266851 missense probably damaging 1.00
R6036:Tpcn2 UTSW 7 145268869 missense possibly damaging 0.93
R6036:Tpcn2 UTSW 7 145268869 missense possibly damaging 0.93
R6299:Tpcn2 UTSW 7 145262243 missense probably damaging 1.00
R6337:Tpcn2 UTSW 7 145279343 missense probably damaging 1.00
R6382:Tpcn2 UTSW 7 145269749 missense possibly damaging 0.88
R6995:Tpcn2 UTSW 7 145256785 missense probably benign 0.00
R7494:Tpcn2 UTSW 7 145278849 missense possibly damaging 0.91
R8052:Tpcn2 UTSW 7 145260946 missense probably benign 0.06
Y4335:Tpcn2 UTSW 7 145257235 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGAGCCACCTGACTGTTCC -3'
(R):5'- TGTCTCCAGGTCTAGCTCAC -3'

Sequencing Primer
(F):5'- CACCAAGGTGCAGAAGCCTG -3'
(R):5'- AGGTCTAGCTCACCTGGGACTC -3'
Posted On2018-08-01