Incidental Mutation 'R6724:Wdr6'
ID529769
Institutional Source Beutler Lab
Gene Symbol Wdr6
Ensembl Gene ENSMUSG00000066357
Gene NameWD repeat domain 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R6724 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108572311-108578739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108574894 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 597 (H597Y)
Ref Sequence ENSEMBL: ENSMUSP00000070927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006853] [ENSMUST00000019183] [ENSMUST00000068700] [ENSMUST00000193427] [ENSMUST00000195249]
Predicted Effect probably benign
Transcript: ENSMUST00000006853
SMART Domains Protein: ENSMUSP00000006853
Gene: ENSMUSG00000006675

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
P4Hc 143 460 1.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019183
SMART Domains Protein: ENSMUSP00000019183
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 288 301 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
DALR_1 399 538 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068700
AA Change: H597Y

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357
AA Change: H597Y

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191897
Predicted Effect probably benign
Transcript: ENSMUST00000192518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193044
Predicted Effect probably benign
Transcript: ENSMUST00000193427
SMART Domains Protein: ENSMUSP00000141748
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
DALR_1 68 171 1.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193846
Predicted Effect probably benign
Transcript: ENSMUST00000195249
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. The encoded protein interacts with serine/threonine kinase 11, and is implicated in cell growth arrest. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 T A 16: 85,868,557 T619S probably benign Het
Adgra2 G A 8: 27,114,182 A467T possibly damaging Het
AF366264 A T 8: 13,837,083 L336Q probably damaging Het
Alox5 A T 6: 116,414,548 I416N probably damaging Het
Blmh A G 11: 76,971,907 probably null Het
Cftr T A 6: 18,255,974 Y567* probably null Het
Cnr1 T A 4: 33,944,728 M372K possibly damaging Het
Col6a3 T C 1: 90,779,152 T2080A unknown Het
Crybg3 A T 16: 59,544,138 C2374S probably benign Het
Csmd2 A G 4: 128,563,371 I3544V probably damaging Het
Dnah12 A T 14: 26,796,223 D1809V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajb12 A G 10: 59,892,780 D190G possibly damaging Het
Dtnb T A 12: 3,686,817 V319D probably damaging Het
Ercc6 A T 14: 32,566,331 E820V probably benign Het
Fip1l1 T G 5: 74,591,774 V378G probably damaging Het
Gabrg1 T A 5: 70,754,209 Y358F possibly damaging Het
Gcn1l1 T G 5: 115,609,158 probably null Het
Gm11011 T A 2: 169,587,482 T28S unknown Het
Gm13762 T G 2: 88,973,268 I208L probably benign Het
Gm14025 A C 2: 129,038,056 V650G probably benign Het
Gm4027 A T 12: 87,621,984 I129F unknown Het
Guf1 C A 5: 69,566,393 N438K probably damaging Het
Hoxa7 T C 6: 52,215,739 E223G probably benign Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ipo8 A T 6: 148,809,975 probably null Het
Isl2 A G 9: 55,541,288 D3G possibly damaging Het
Kcnb2 A G 1: 15,710,440 Y512C probably damaging Het
Kifc1 T A 17: 33,886,733 probably null Het
Klhdc10 A G 6: 30,446,641 D183G probably damaging Het
Klra5 T A 6: 129,906,680 K71N probably benign Het
Lrp6 T C 6: 134,486,541 H559R possibly damaging Het
Maml3 T C 3: 51,855,875 N556S probably damaging Het
Man2a1 A G 17: 64,731,269 I83V possibly damaging Het
Mrgpra9 A G 7: 47,235,038 S293P probably damaging Het
Nalcn A G 14: 123,298,067 S1282P probably damaging Het
Npepps A T 11: 97,206,002 probably benign Het
Olfr1037 A T 2: 86,085,357 V140E possibly damaging Het
Olfr1154 T G 2: 87,903,602 S25R probably benign Het
Olfr1245 A T 2: 89,574,965 F254I probably benign Het
Pkn3 C A 2: 30,090,550 R818S possibly damaging Het
Plekha3 T A 2: 76,687,401 H190Q probably damaging Het
Ppp2r3c A T 12: 55,288,496 S261T probably benign Het
Ptprj T C 2: 90,450,851 D1015G probably benign Het
Pus10 T C 11: 23,729,037 M503T possibly damaging Het
Pvr T C 7: 19,918,679 R104G possibly damaging Het
Rubcnl A G 14: 75,052,010 R653G probably benign Het
Serpina1a G T 12: 103,860,420 probably benign Het
Shank3 G A 15: 89,532,453 R265Q probably damaging Het
Slc22a22 C T 15: 57,247,532 R433H probably damaging Het
Slc22a26 A G 19: 7,802,361 I30T probably benign Het
Spz1 A T 13: 92,575,484 N161K possibly damaging Het
Tacc2 A G 7: 130,728,762 R259G probably damaging Het
Top1 G A 2: 160,712,696 V456M probably damaging Het
Tpcn2 G A 7: 145,256,520 A649V probably benign Het
Trank1 C G 9: 111,365,916 R1003G probably damaging Het
Tril T A 6: 53,819,574 H221L possibly damaging Het
Unc79 C T 12: 103,104,861 T1305I probably damaging Het
Unc80 C T 1: 66,683,191 A2988V possibly damaging Het
Vmn1r81 A T 7: 12,260,672 M3K probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Vwa3b G A 1: 37,045,031 R95Q probably damaging Het
Yme1l1 C T 2: 23,194,762 T624I probably damaging Het
Other mutations in Wdr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Wdr6 APN 9 108574897 missense possibly damaging 0.77
IGL01757:Wdr6 APN 9 108576228 missense possibly damaging 0.65
IGL02096:Wdr6 APN 9 108576553 missense probably damaging 1.00
IGL02577:Wdr6 APN 9 108575941 missense possibly damaging 0.88
IGL02625:Wdr6 APN 9 108575505 missense probably damaging 1.00
IGL02820:Wdr6 APN 9 108578544 missense probably benign 0.28
IGL03250:Wdr6 APN 9 108573197 missense possibly damaging 0.95
PIT4802001:Wdr6 UTSW 9 108574566 missense probably damaging 1.00
R0038:Wdr6 UTSW 9 108572969 missense probably damaging 1.00
R0153:Wdr6 UTSW 9 108575242 missense probably damaging 1.00
R0378:Wdr6 UTSW 9 108575864 missense probably damaging 1.00
R0420:Wdr6 UTSW 9 108573101 missense probably benign 0.41
R1620:Wdr6 UTSW 9 108574655 missense possibly damaging 0.51
R1753:Wdr6 UTSW 9 108575164 missense probably damaging 0.99
R1844:Wdr6 UTSW 9 108575977 missense probably damaging 1.00
R1881:Wdr6 UTSW 9 108573179 unclassified probably null
R1987:Wdr6 UTSW 9 108576534 missense probably damaging 1.00
R2029:Wdr6 UTSW 9 108575355 missense probably damaging 1.00
R2139:Wdr6 UTSW 9 108574123 missense probably benign 0.00
R3900:Wdr6 UTSW 9 108575769 missense probably damaging 1.00
R4021:Wdr6 UTSW 9 108575206 missense probably damaging 1.00
R4909:Wdr6 UTSW 9 108572988 missense probably benign 0.28
R5073:Wdr6 UTSW 9 108574366 missense probably damaging 1.00
R5748:Wdr6 UTSW 9 108575782 missense possibly damaging 0.75
R6039:Wdr6 UTSW 9 108573795 frame shift probably null
R6039:Wdr6 UTSW 9 108573795 frame shift probably null
R6254:Wdr6 UTSW 9 108574911 missense probably damaging 1.00
R7134:Wdr6 UTSW 9 108573365 missense probably damaging 1.00
R7248:Wdr6 UTSW 9 108576039 missense possibly damaging 0.82
R7296:Wdr6 UTSW 9 108574585 missense probably damaging 1.00
R7388:Wdr6 UTSW 9 108574772 missense probably damaging 1.00
R7443:Wdr6 UTSW 9 108574290 missense probably damaging 1.00
R7467:Wdr6 UTSW 9 108573002 missense probably benign 0.14
R7672:Wdr6 UTSW 9 108573748 missense probably benign 0.06
R7699:Wdr6 UTSW 9 108576361 missense possibly damaging 0.92
R7700:Wdr6 UTSW 9 108576361 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCCTCAGTATCAGAAAAGGC -3'
(R):5'- TATTACTGCAGCTGAGGCAC -3'

Sequencing Primer
(F):5'- CTCAGTATCAGAAAAGGCCCAGG -3'
(R):5'- GCACCTGGAGCTGGTAGTG -3'
Posted On2018-08-01