Incidental Mutation 'R6724:Dtnb'
ID529775
Institutional Source Beutler Lab
Gene Symbol Dtnb
Ensembl Gene ENSMUSG00000071454
Gene Namedystrobrevin, beta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6724 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location3572381-3781796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3686817 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 319 (V319D)
Ref Sequence ENSEMBL: ENSMUSP00000134519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077930] [ENSMUST00000101637] [ENSMUST00000164578] [ENSMUST00000164607] [ENSMUST00000173199] [ENSMUST00000173240] [ENSMUST00000173483] [ENSMUST00000173736] [ENSMUST00000174109] [ENSMUST00000174290] [ENSMUST00000174547] [ENSMUST00000174639] [ENSMUST00000174663]
Predicted Effect probably benign
Transcript: ENSMUST00000077930
AA Change: V319D

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000077085
Gene: ENSMUSG00000071454
AA Change: V319D

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.7e-40 PFAM
Pfam:EF-hand_3 144 232 1.1e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101637
AA Change: V319D

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099161
Gene: ENSMUSG00000071454
AA Change: V319D

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.1e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164578
AA Change: V319D

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126194
Gene: ENSMUSG00000071454
AA Change: V319D

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 7.9e-38 PFAM
Pfam:EF-hand_3 144 232 2.1e-33 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164607
AA Change: V319D

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128230
Gene: ENSMUSG00000071454
AA Change: V319D

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2.1e-40 PFAM
Pfam:EF-hand_3 144 232 1.5e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168806
Predicted Effect unknown
Transcript: ENSMUST00000172598
AA Change: V132D
SMART Domains Protein: ENSMUSP00000134124
Gene: ENSMUSG00000071454
AA Change: V132D

DomainStartEndE-ValueType
Pfam:EF-hand_3 1 46 7.7e-15 PFAM
ZnF_ZZ 51 96 3.29e-15 SMART
low complexity region 217 230 N/A INTRINSIC
coiled coil region 242 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173074
Predicted Effect possibly damaging
Transcript: ENSMUST00000173199
AA Change: V319D

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134392
Gene: ENSMUSG00000071454
AA Change: V319D

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2e-40 PFAM
Pfam:EF-hand_3 144 232 1.6e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 9e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173240
AA Change: V319D

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133722
Gene: ENSMUSG00000071454
AA Change: V319D

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.3e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 373 386 N/A INTRINSIC
SCOP:d1eq1a_ 404 494 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173483
SMART Domains Protein: ENSMUSP00000134390
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 61 7.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173736
AA Change: V319D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134519
Gene: ENSMUSG00000071454
AA Change: V319D

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.3e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 373 386 N/A INTRINSIC
coiled coil region 399 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174109
SMART Domains Protein: ENSMUSP00000134151
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 132 1.1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174290
SMART Domains Protein: ENSMUSP00000133697
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 6e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174547
AA Change: V319D

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133927
Gene: ENSMUSG00000071454
AA Change: V319D

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2e-40 PFAM
Pfam:EF-hand_3 144 232 1.4e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174639
SMART Domains Protein: ENSMUSP00000133601
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 123 6.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174663
AA Change: V319D

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134146
Gene: ENSMUSG00000071454
AA Change: V319D

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2.2e-40 PFAM
Pfam:EF-hand_3 144 232 1.5e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 4e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and show no obvious histological or functional abnormalities in liver and kidney. Mice homozygous for a gene trapped allele are viable, fertile and overtly normal with no significant synaptic or behavioral defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 T A 16: 85,868,557 T619S probably benign Het
Adgra2 G A 8: 27,114,182 A467T possibly damaging Het
AF366264 A T 8: 13,837,083 L336Q probably damaging Het
Alox5 A T 6: 116,414,548 I416N probably damaging Het
Blmh A G 11: 76,971,907 probably null Het
Cftr T A 6: 18,255,974 Y567* probably null Het
Cnr1 T A 4: 33,944,728 M372K possibly damaging Het
Col6a3 T C 1: 90,779,152 T2080A unknown Het
Crybg3 A T 16: 59,544,138 C2374S probably benign Het
Csmd2 A G 4: 128,563,371 I3544V probably damaging Het
Dnah12 A T 14: 26,796,223 D1809V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajb12 A G 10: 59,892,780 D190G possibly damaging Het
Ercc6 A T 14: 32,566,331 E820V probably benign Het
Fip1l1 T G 5: 74,591,774 V378G probably damaging Het
Gabrg1 T A 5: 70,754,209 Y358F possibly damaging Het
Gcn1l1 T G 5: 115,609,158 probably null Het
Gm11011 T A 2: 169,587,482 T28S unknown Het
Gm13762 T G 2: 88,973,268 I208L probably benign Het
Gm14025 A C 2: 129,038,056 V650G probably benign Het
Gm4027 A T 12: 87,621,984 I129F unknown Het
Guf1 C A 5: 69,566,393 N438K probably damaging Het
Hoxa7 T C 6: 52,215,739 E223G probably benign Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ipo8 A T 6: 148,809,975 probably null Het
Isl2 A G 9: 55,541,288 D3G possibly damaging Het
Kcnb2 A G 1: 15,710,440 Y512C probably damaging Het
Kifc1 T A 17: 33,886,733 probably null Het
Klhdc10 A G 6: 30,446,641 D183G probably damaging Het
Klra5 T A 6: 129,906,680 K71N probably benign Het
Lrp6 T C 6: 134,486,541 H559R possibly damaging Het
Maml3 T C 3: 51,855,875 N556S probably damaging Het
Man2a1 A G 17: 64,731,269 I83V possibly damaging Het
Mrgpra9 A G 7: 47,235,038 S293P probably damaging Het
Nalcn A G 14: 123,298,067 S1282P probably damaging Het
Npepps A T 11: 97,206,002 probably benign Het
Olfr1037 A T 2: 86,085,357 V140E possibly damaging Het
Olfr1154 T G 2: 87,903,602 S25R probably benign Het
Olfr1245 A T 2: 89,574,965 F254I probably benign Het
Pkn3 C A 2: 30,090,550 R818S possibly damaging Het
Plekha3 T A 2: 76,687,401 H190Q probably damaging Het
Ppp2r3c A T 12: 55,288,496 S261T probably benign Het
Ptprj T C 2: 90,450,851 D1015G probably benign Het
Pus10 T C 11: 23,729,037 M503T possibly damaging Het
Pvr T C 7: 19,918,679 R104G possibly damaging Het
Rubcnl A G 14: 75,052,010 R653G probably benign Het
Serpina1a G T 12: 103,860,420 probably benign Het
Shank3 G A 15: 89,532,453 R265Q probably damaging Het
Slc22a22 C T 15: 57,247,532 R433H probably damaging Het
Slc22a26 A G 19: 7,802,361 I30T probably benign Het
Spz1 A T 13: 92,575,484 N161K possibly damaging Het
Tacc2 A G 7: 130,728,762 R259G probably damaging Het
Top1 G A 2: 160,712,696 V456M probably damaging Het
Tpcn2 G A 7: 145,256,520 A649V probably benign Het
Trank1 C G 9: 111,365,916 R1003G probably damaging Het
Tril T A 6: 53,819,574 H221L possibly damaging Het
Unc79 C T 12: 103,104,861 T1305I probably damaging Het
Unc80 C T 1: 66,683,191 A2988V possibly damaging Het
Vmn1r81 A T 7: 12,260,672 M3K probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Vwa3b G A 1: 37,045,031 R95Q probably damaging Het
Wdr6 G A 9: 108,574,894 H597Y probably benign Het
Yme1l1 C T 2: 23,194,762 T624I probably damaging Het
Other mutations in Dtnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Dtnb APN 12 3732626 missense probably benign 0.00
IGL02269:Dtnb APN 12 3596691 missense probably damaging 1.00
IGL02710:Dtnb APN 12 3648380 missense possibly damaging 0.93
R0004:Dtnb UTSW 12 3596635 splice site probably benign
R0449:Dtnb UTSW 12 3591971 nonsense probably null
R0601:Dtnb UTSW 12 3735039 splice site probably benign
R1242:Dtnb UTSW 12 3732627 nonsense probably null
R1582:Dtnb UTSW 12 3773554 missense possibly damaging 0.78
R1719:Dtnb UTSW 12 3643936 nonsense probably null
R1960:Dtnb UTSW 12 3781190 missense probably benign 0.34
R2073:Dtnb UTSW 12 3781273 missense probably benign
R2074:Dtnb UTSW 12 3781273 missense probably benign
R3423:Dtnb UTSW 12 3591962 nonsense probably null
R3708:Dtnb UTSW 12 3589156 splice site probably null
R4788:Dtnb UTSW 12 3772699 missense probably damaging 1.00
R4816:Dtnb UTSW 12 3749505 missense probably damaging 0.99
R5086:Dtnb UTSW 12 3632942 missense probably benign 0.19
R5725:Dtnb UTSW 12 3773566 missense probably damaging 1.00
R6835:Dtnb UTSW 12 3632841 intron probably benign
R6912:Dtnb UTSW 12 3648221 critical splice acceptor site probably null
R7078:Dtnb UTSW 12 3748480 missense possibly damaging 0.80
R7105:Dtnb UTSW 12 3648391 critical splice donor site probably null
R7408:Dtnb UTSW 12 3644272 intron probably null
R7538:Dtnb UTSW 12 3773611 missense possibly damaging 0.80
X0026:Dtnb UTSW 12 3686814 missense probably damaging 1.00
X0060:Dtnb UTSW 12 3596690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGTGAAATCTGATTGGTGC -3'
(R):5'- GTGGCAGACAACCCAATTCC -3'

Sequencing Primer
(F):5'- TGGTGCTTGAAAAGATATTTCCC -3'
(R):5'- ACCATAATCGTTCTTTGGGGTAC -3'
Posted On2018-08-01