Incidental Mutation 'R6724:Ppp2r3c'
ID529776
Institutional Source Beutler Lab
Gene Symbol Ppp2r3c
Ensembl Gene ENSMUSG00000021022
Gene Nameprotein phosphatase 2, regulatory subunit B'', gamma
Synonyms4930511A21Rik, G5pr, G4-1, 5730412A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6724 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location55278991-55302998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55288496 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 261 (S261T)
Ref Sequence ENSEMBL: ENSMUSP00000021410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021410]
Predicted Effect probably benign
Transcript: ENSMUST00000021410
AA Change: S261T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000021410
Gene: ENSMUSG00000021022
AA Change: S261T

DomainStartEndE-ValueType
PDB:4I5K|B 188 437 1e-25 PDB
SCOP:d1dgua_ 258 413 4e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219809
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory subunit of the serine/threonine phosphatase, protein phosphatase 2. This protein is localized to both nuclear and cytoplasmic regions depending on cell cycle phase. Homozygous conditional knockout mice for this gene exhibit reduced numbers and impaired proliferation of immune system B cells. This protein may regulate the expression of the P-glycoprotein ATP-binding cassette transporter through its phosphatase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 T A 16: 85,868,557 T619S probably benign Het
Adgra2 G A 8: 27,114,182 A467T possibly damaging Het
AF366264 A T 8: 13,837,083 L336Q probably damaging Het
Alox5 A T 6: 116,414,548 I416N probably damaging Het
Blmh A G 11: 76,971,907 probably null Het
Cftr T A 6: 18,255,974 Y567* probably null Het
Cnr1 T A 4: 33,944,728 M372K possibly damaging Het
Col6a3 T C 1: 90,779,152 T2080A unknown Het
Crybg3 A T 16: 59,544,138 C2374S probably benign Het
Csmd2 A G 4: 128,563,371 I3544V probably damaging Het
Dnah12 A T 14: 26,796,223 D1809V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajb12 A G 10: 59,892,780 D190G possibly damaging Het
Dtnb T A 12: 3,686,817 V319D probably damaging Het
Ercc6 A T 14: 32,566,331 E820V probably benign Het
Fip1l1 T G 5: 74,591,774 V378G probably damaging Het
Gabrg1 T A 5: 70,754,209 Y358F possibly damaging Het
Gcn1l1 T G 5: 115,609,158 probably null Het
Gm11011 T A 2: 169,587,482 T28S unknown Het
Gm13762 T G 2: 88,973,268 I208L probably benign Het
Gm14025 A C 2: 129,038,056 V650G probably benign Het
Gm4027 A T 12: 87,621,984 I129F unknown Het
Guf1 C A 5: 69,566,393 N438K probably damaging Het
Hoxa7 T C 6: 52,215,739 E223G probably benign Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ipo8 A T 6: 148,809,975 probably null Het
Isl2 A G 9: 55,541,288 D3G possibly damaging Het
Kcnb2 A G 1: 15,710,440 Y512C probably damaging Het
Kifc1 T A 17: 33,886,733 probably null Het
Klhdc10 A G 6: 30,446,641 D183G probably damaging Het
Klra5 T A 6: 129,906,680 K71N probably benign Het
Lrp6 T C 6: 134,486,541 H559R possibly damaging Het
Maml3 T C 3: 51,855,875 N556S probably damaging Het
Man2a1 A G 17: 64,731,269 I83V possibly damaging Het
Mrgpra9 A G 7: 47,235,038 S293P probably damaging Het
Nalcn A G 14: 123,298,067 S1282P probably damaging Het
Npepps A T 11: 97,206,002 probably benign Het
Olfr1037 A T 2: 86,085,357 V140E possibly damaging Het
Olfr1154 T G 2: 87,903,602 S25R probably benign Het
Olfr1245 A T 2: 89,574,965 F254I probably benign Het
Pkn3 C A 2: 30,090,550 R818S possibly damaging Het
Plekha3 T A 2: 76,687,401 H190Q probably damaging Het
Ptprj T C 2: 90,450,851 D1015G probably benign Het
Pus10 T C 11: 23,729,037 M503T possibly damaging Het
Pvr T C 7: 19,918,679 R104G possibly damaging Het
Rubcnl A G 14: 75,052,010 R653G probably benign Het
Serpina1a G T 12: 103,860,420 probably benign Het
Shank3 G A 15: 89,532,453 R265Q probably damaging Het
Slc22a22 C T 15: 57,247,532 R433H probably damaging Het
Slc22a26 A G 19: 7,802,361 I30T probably benign Het
Spz1 A T 13: 92,575,484 N161K possibly damaging Het
Tacc2 A G 7: 130,728,762 R259G probably damaging Het
Top1 G A 2: 160,712,696 V456M probably damaging Het
Tpcn2 G A 7: 145,256,520 A649V probably benign Het
Trank1 C G 9: 111,365,916 R1003G probably damaging Het
Tril T A 6: 53,819,574 H221L possibly damaging Het
Unc79 C T 12: 103,104,861 T1305I probably damaging Het
Unc80 C T 1: 66,683,191 A2988V possibly damaging Het
Vmn1r81 A T 7: 12,260,672 M3K probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Vwa3b G A 1: 37,045,031 R95Q probably damaging Het
Wdr6 G A 9: 108,574,894 H597Y probably benign Het
Yme1l1 C T 2: 23,194,762 T624I probably damaging Het
Other mutations in Ppp2r3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Ppp2r3c APN 12 55292498 splice site probably null
IGL01122:Ppp2r3c APN 12 55297802 missense probably benign 0.20
IGL01954:Ppp2r3c APN 12 55292568 missense probably damaging 1.00
IGL02939:Ppp2r3c APN 12 55298407 unclassified probably benign
R0045:Ppp2r3c UTSW 12 55293821 missense probably damaging 0.99
R0129:Ppp2r3c UTSW 12 55298422 missense probably damaging 0.96
R2411:Ppp2r3c UTSW 12 55298484 missense probably benign 0.19
R4468:Ppp2r3c UTSW 12 55297883 nonsense probably null
R4746:Ppp2r3c UTSW 12 55302635 unclassified probably null
R5499:Ppp2r3c UTSW 12 55288626 missense probably benign 0.09
R5724:Ppp2r3c UTSW 12 55297832 missense probably benign 0.45
R6776:Ppp2r3c UTSW 12 55298467 nonsense probably null
R7706:Ppp2r3c UTSW 12 55281705 missense probably benign 0.23
R7975:Ppp2r3c UTSW 12 55287993 nonsense probably null
R8111:Ppp2r3c UTSW 12 55297849 missense probably benign
RF006:Ppp2r3c UTSW 12 55293815 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GCAGTACTGATCCTTGAGTGGG -3'
(R):5'- CGTATCAATTATAGGCTTGCCTTTG -3'

Sequencing Primer
(F):5'- GCAGACAGCCTATGTACA -3'
(R):5'- GGCTTGCCTTTGTAAAATAACATC -3'
Posted On2018-08-01