Mutagenetix > Incidental Mutation

Incidental Mutation 'R6724:Adamts5'

529788

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R6724 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85868557 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 619 (T619S)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

probably benign
Transcript: ENSMUST00000023611
AA Change: T619S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: T619S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgra2	G	A	8: 27,114,182	A467T	possibly damaging	Het
AF366264	A	T	8: 13,837,083	L336Q	probably damaging	Het
Alox5	A	T	6: 116,414,548	I416N	probably damaging	Het
Blmh	A	G	11: 76,971,907		probably null	Het
Cftr	T	A	6: 18,255,974	Y567*	probably null	Het
Cnr1	T	A	4: 33,944,728	M372K	possibly damaging	Het
Col6a3	T	C	1: 90,779,152	T2080A	unknown	Het
Crybg3	A	T	16: 59,544,138	C2374S	probably benign	Het
Csmd2	A	G	4: 128,563,371	I3544V	probably damaging	Het
Dnah12	A	T	14: 26,796,223	D1809V	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dnajb12	A	G	10: 59,892,780	D190G	possibly damaging	Het
Dtnb	T	A	12: 3,686,817	V319D	probably damaging	Het
Ercc6	A	T	14: 32,566,331	E820V	probably benign	Het
Fip1l1	T	G	5: 74,591,774	V378G	probably damaging	Het
Gabrg1	T	A	5: 70,754,209	Y358F	possibly damaging	Het
Gcn1l1	T	G	5: 115,609,158		probably null	Het
Gm11011	T	A	2: 169,587,482	T28S	unknown	Het
Gm13762	T	G	2: 88,973,268	I208L	probably benign	Het
Gm14025	A	C	2: 129,038,056	V650G	probably benign	Het
Gm4027	A	T	12: 87,621,984	I129F	unknown	Het
Guf1	C	A	5: 69,566,393	N438K	probably damaging	Het
Hoxa7	T	C	6: 52,215,739	E223G	probably benign	Het
Hspg2	G	A	4: 137,515,307	G611E	probably damaging	Het
Ipo8	A	T	6: 148,809,975		probably null	Het
Isl2	A	G	9: 55,541,288	D3G	possibly damaging	Het
Kcnb2	A	G	1: 15,710,440	Y512C	probably damaging	Het
Kifc1	T	A	17: 33,886,733		probably null	Het
Klhdc10	A	G	6: 30,446,641	D183G	probably damaging	Het
Klra5	T	A	6: 129,906,680	K71N	probably benign	Het
Lrp6	T	C	6: 134,486,541	H559R	possibly damaging	Het
Maml3	T	C	3: 51,855,875	N556S	probably damaging	Het
Man2a1	A	G	17: 64,731,269	I83V	possibly damaging	Het
Mrgpra9	A	G	7: 47,235,038	S293P	probably damaging	Het
Nalcn	A	G	14: 123,298,067	S1282P	probably damaging	Het
Npepps	A	T	11: 97,206,002		probably benign	Het
Olfr1037	A	T	2: 86,085,357	V140E	possibly damaging	Het
Olfr1154	T	G	2: 87,903,602	S25R	probably benign	Het
Olfr1245	A	T	2: 89,574,965	F254I	probably benign	Het
Pkn3	C	A	2: 30,090,550	R818S	possibly damaging	Het
Plekha3	T	A	2: 76,687,401	H190Q	probably damaging	Het
Ppp2r3c	A	T	12: 55,288,496	S261T	probably benign	Het
Ptprj	T	C	2: 90,450,851	D1015G	probably benign	Het
Pus10	T	C	11: 23,729,037	M503T	possibly damaging	Het
Pvr	T	C	7: 19,918,679	R104G	possibly damaging	Het
Rubcnl	A	G	14: 75,052,010	R653G	probably benign	Het
Serpina1a	G	T	12: 103,860,420		probably benign	Het
Shank3	G	A	15: 89,532,453	R265Q	probably damaging	Het
Slc22a22	C	T	15: 57,247,532	R433H	probably damaging	Het
Slc22a26	A	G	19: 7,802,361	I30T	probably benign	Het
Spz1	A	T	13: 92,575,484	N161K	possibly damaging	Het
Tacc2	A	G	7: 130,728,762	R259G	probably damaging	Het
Top1	G	A	2: 160,712,696	V456M	probably damaging	Het
Tpcn2	G	A	7: 145,256,520	A649V	probably benign	Het
Trank1	C	G	9: 111,365,916	R1003G	probably damaging	Het
Tril	T	A	6: 53,819,574	H221L	possibly damaging	Het
Unc79	C	T	12: 103,104,861	T1305I	probably damaging	Het
Unc80	C	T	1: 66,683,191	A2988V	possibly damaging	Het
Vmn1r81	A	T	7: 12,260,672	M3K	probably damaging	Het
Vmn2r78	A	T	7: 86,954,258	D548V	probably damaging	Het
Vwa3b	G	A	1: 37,045,031	R95Q	probably damaging	Het
Wdr6	G	A	9: 108,574,894	H597Y	probably benign	Het
Yme1l1	C	T	2: 23,194,762	T624I	probably damaging	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
R9455:Adamts5	UTSW	16	85870129	missense	probably damaging	0.99
R9616:Adamts5	UTSW	16	85862786	missense	probably benign	0.34
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGAAGTGTTGTCTCCCCATC -3'
(R):5'- TCTATTTCAGACATCAAGCCATGG -3'

Sequencing Primer
(F):5'- GATGTCTGTGACAGTAAACTAACCC -3'
(R):5'- TTCAGACATCAAGCCATGGAAATTGG -3'

Posted On

2018-08-01