Incidental Mutation 'R6725:Ppp1r42'
ID529793
Institutional Source Beutler Lab
Gene Symbol Ppp1r42
Ensembl Gene ENSMUSG00000025916
Gene Nameprotein phosphatase 1, regulatory subunit 42
Synonyms1700011J18Rik, 4930418G15Rik, Lrrc67
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6725 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location9968624-10009136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 9999507 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 110 (E110A)
Ref Sequence ENSEMBL: ENSMUSP00000115030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027049] [ENSMUST00000124874] [ENSMUST00000130102] [ENSMUST00000176398]
Predicted Effect probably damaging
Transcript: ENSMUST00000027049
AA Change: E110A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027049
Gene: ENSMUSG00000025916
AA Change: E110A

DomainStartEndE-ValueType
Pfam:LRR_8 50 106 2.5e-8 PFAM
Pfam:LRR_4 72 114 2.3e-11 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 243 259 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124874
AA Change: E110A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115309
Gene: ENSMUSG00000025916
AA Change: E110A

DomainStartEndE-ValueType
Pfam:LRR_8 50 106 2e-8 PFAM
Pfam:LRR_6 71 94 5.9e-3 PFAM
Pfam:LRR_4 72 117 3.8e-11 PFAM
Pfam:LRR_8 72 128 1.3e-8 PFAM
Pfam:LRR_1 73 93 3.4e-3 PFAM
Pfam:LRR_6 145 172 2.2e-3 PFAM
low complexity region 184 201 N/A INTRINSIC
low complexity region 243 259 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130102
AA Change: E110A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115030
Gene: ENSMUSG00000025916
AA Change: E110A

DomainStartEndE-ValueType
Pfam:LRR_6 49 68 4.4e-2 PFAM
Pfam:LRR_8 50 106 2.3e-8 PFAM
Pfam:LRR_6 71 95 6.8e-3 PFAM
Pfam:LRR_4 72 116 6.9e-11 PFAM
Pfam:LRR_8 72 128 1.5e-8 PFAM
Pfam:LRR_1 73 93 5.1e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155163
Predicted Effect probably benign
Transcript: ENSMUST00000176398
SMART Domains Protein: ENSMUSP00000135276
Gene: ENSMUSG00000025916

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Meta Mutation Damage Score 0.3560 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can interact with gamma-tubulin and PP1 phosphatase, a regulator of centrosome separation. The encoded protein is a positive regulator of PP1 phosphatase and thus plays a role in the control of centrosome integrity. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,743,201 Y623C probably damaging Het
Adgrv1 T C 13: 81,437,557 E4596G probably damaging Het
Adgrv1 A T 13: 81,493,210 C3267S probably damaging Het
Ankrd40 T G 11: 94,334,815 V224G probably benign Het
Ap3s2 C T 7: 79,920,642 probably benign Het
Apip T A 2: 103,092,525 D229E possibly damaging Het
Atp2b4 C T 1: 133,706,987 R1168H probably benign Het
Bcan T C 3: 87,995,484 K329R possibly damaging Het
Camk1g T C 1: 193,350,320 D261G possibly damaging Het
Ccdc30 T A 4: 119,331,599 Q490L probably damaging Het
Ccdc83 A G 7: 90,247,053 W103R probably damaging Het
Ctsl T A 13: 64,366,623 R69* probably null Het
Dchs1 C T 7: 105,758,793 R1944H probably damaging Het
Fgb T C 3: 83,043,791 Y305C probably damaging Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Gal3st2 T A 1: 93,873,702 S27T probably benign Het
Galnt13 A G 2: 54,855,232 D228G probably damaging Het
Gk5 A T 9: 96,155,470 T346S probably benign Het
Gnrhr T C 5: 86,185,313 I233V probably damaging Het
Greb1 T C 12: 16,688,567 Y1465C probably damaging Het
H6pd A G 4: 149,996,358 L10P probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ighv7-4 A T 12: 114,222,869 D94E probably damaging Het
Lamb3 T C 1: 193,304,582 Y59H probably benign Het
Msantd1 C T 5: 34,921,421 T100I probably damaging Het
Msx3 T A 7: 140,048,746 probably benign Het
Mttp C A 3: 138,107,238 A559S probably damaging Het
Myh1 C G 11: 67,201,893 D4E probably damaging Het
Olfr1018 A G 2: 85,823,790 K273R probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1295 C T 2: 111,564,907 C179Y probably damaging Het
Olfr596 A T 7: 103,310,354 D211V probably damaging Het
Pcdhac1 T C 18: 37,090,328 Y65H probably damaging Het
Pcdhga8 A T 18: 37,727,262 Y457F probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pja2 A T 17: 64,289,967 M514K probably damaging Het
Plcxd2 T C 16: 45,972,125 N284D probably damaging Het
Polr3d A T 14: 70,441,137 M129K probably benign Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prelid2 A G 18: 41,912,449 I132T possibly damaging Het
Sergef G A 7: 46,632,667 probably null Het
Slc24a2 C A 4: 87,226,882 probably null Het
Stxbp3 A T 3: 108,827,600 D24E possibly damaging Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Thsd7a G A 6: 12,555,631 H85Y possibly damaging Het
Tlr2 T A 3: 83,838,296 E160V probably benign Het
Tmem171 A T 13: 98,692,170 C157* probably null Het
Trpm3 T C 19: 22,926,028 Y1051H probably damaging Het
Vmn2r28 A G 7: 5,488,409 F280L probably benign Het
Xpo7 A T 14: 70,676,813 Y748N probably damaging Het
Zan T C 5: 137,438,520 S2024G unknown Het
Zfhx2 A T 14: 55,064,082 Y2148* probably null Het
Zscan4-ps1 T C 7: 11,065,979 T328A probably benign Het
Other mutations in Ppp1r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Ppp1r42 APN 1 10003233 critical splice donor site probably null
IGL02739:Ppp1r42 APN 1 9968853 missense probably benign 0.34
R0920:Ppp1r42 UTSW 1 9999525 missense probably damaging 1.00
R1829:Ppp1r42 UTSW 1 10000086 missense probably benign 0.00
R2151:Ppp1r42 UTSW 1 10003347 missense probably benign 0.10
R2909:Ppp1r42 UTSW 1 10003412 intron probably benign
R4828:Ppp1r42 UTSW 1 9999411 missense probably benign
R4863:Ppp1r42 UTSW 1 10003386 intron probably benign
R5384:Ppp1r42 UTSW 1 9999435 missense probably damaging 1.00
R5394:Ppp1r42 UTSW 1 9999405 missense probably damaging 1.00
R7343:Ppp1r42 UTSW 1 9968857 missense probably benign
R7556:Ppp1r42 UTSW 1 9995183 missense probably benign 0.01
Z1177:Ppp1r42 UTSW 1 9999427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTACATCCTCGGCTCTC -3'
(R):5'- TTGTGACCCTCTGGAGAGTTCG -3'

Sequencing Primer
(F):5'- CGGCTCTCCTGCTCCAC -3'
(R):5'- GAACTCTGGGATTACCTACGC -3'
Posted On2018-08-01