Incidental Mutation 'R6725:Ppp1r42'
ID 529793
Institutional Source Beutler Lab
Gene Symbol Ppp1r42
Ensembl Gene ENSMUSG00000025916
Gene Name protein phosphatase 1, regulatory subunit 42
Synonyms 1700011J18Rik, 4930418G15Rik, Lrrc67
MMRRC Submission 044843-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6725 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 10038849-10079361 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 10069732 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 110 (E110A)
Ref Sequence ENSEMBL: ENSMUSP00000115030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027049] [ENSMUST00000124874] [ENSMUST00000130102] [ENSMUST00000176398]
AlphaFold Q8R1Z4
Predicted Effect probably damaging
Transcript: ENSMUST00000027049
AA Change: E110A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027049
Gene: ENSMUSG00000025916
AA Change: E110A

DomainStartEndE-ValueType
Pfam:LRR_8 50 106 2.5e-8 PFAM
Pfam:LRR_4 72 114 2.3e-11 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 243 259 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124874
AA Change: E110A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115309
Gene: ENSMUSG00000025916
AA Change: E110A

DomainStartEndE-ValueType
Pfam:LRR_8 50 106 2e-8 PFAM
Pfam:LRR_6 71 94 5.9e-3 PFAM
Pfam:LRR_4 72 117 3.8e-11 PFAM
Pfam:LRR_8 72 128 1.3e-8 PFAM
Pfam:LRR_1 73 93 3.4e-3 PFAM
Pfam:LRR_6 145 172 2.2e-3 PFAM
low complexity region 184 201 N/A INTRINSIC
low complexity region 243 259 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130102
AA Change: E110A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115030
Gene: ENSMUSG00000025916
AA Change: E110A

DomainStartEndE-ValueType
Pfam:LRR_6 49 68 4.4e-2 PFAM
Pfam:LRR_8 50 106 2.3e-8 PFAM
Pfam:LRR_6 71 95 6.8e-3 PFAM
Pfam:LRR_4 72 116 6.9e-11 PFAM
Pfam:LRR_8 72 128 1.5e-8 PFAM
Pfam:LRR_1 73 93 5.1e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155163
Predicted Effect probably benign
Transcript: ENSMUST00000176398
SMART Domains Protein: ENSMUSP00000135276
Gene: ENSMUSG00000025916

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Meta Mutation Damage Score 0.3560 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can interact with gamma-tubulin and PP1 phosphatase, a regulator of centrosome separation. The encoded protein is a positive regulator of PP1 phosphatase and thus plays a role in the control of centrosome integrity. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 114,469,833 (GRCm39) Y623C probably damaging Het
Adgrv1 T C 13: 81,585,676 (GRCm39) E4596G probably damaging Het
Adgrv1 A T 13: 81,641,329 (GRCm39) C3267S probably damaging Het
Ankrd40 T G 11: 94,225,641 (GRCm39) V224G probably benign Het
Ap3s2 C T 7: 79,570,390 (GRCm39) probably benign Het
Apip T A 2: 102,922,870 (GRCm39) D229E possibly damaging Het
Atp2b4 C T 1: 133,634,725 (GRCm39) R1168H probably benign Het
Bcan T C 3: 87,902,791 (GRCm39) K329R possibly damaging Het
Camk1g T C 1: 193,032,628 (GRCm39) D261G possibly damaging Het
Ccdc30 T A 4: 119,188,796 (GRCm39) Q490L probably damaging Het
Ccdc83 A G 7: 89,896,261 (GRCm39) W103R probably damaging Het
Ctsl T A 13: 64,514,437 (GRCm39) R69* probably null Het
Dchs1 C T 7: 105,408,000 (GRCm39) R1944H probably damaging Het
Fgb T C 3: 82,951,098 (GRCm39) Y305C probably damaging Het
Fras1 T A 5: 96,929,199 (GRCm39) Y3868N possibly damaging Het
Gal3st2 T A 1: 93,801,424 (GRCm39) S27T probably benign Het
Galnt13 A G 2: 54,745,244 (GRCm39) D228G probably damaging Het
Gk5 A T 9: 96,037,523 (GRCm39) T346S probably benign Het
Gnrhr T C 5: 86,333,172 (GRCm39) I233V probably damaging Het
Greb1 T C 12: 16,738,568 (GRCm39) Y1465C probably damaging Het
H6pd A G 4: 150,080,815 (GRCm39) L10P probably damaging Het
Hspg2 G A 4: 137,242,618 (GRCm39) G611E probably damaging Het
Ighv7-4 A T 12: 114,186,489 (GRCm39) D94E probably damaging Het
Lamb3 T C 1: 192,986,890 (GRCm39) Y59H probably benign Het
Msantd1 C T 5: 35,078,765 (GRCm39) T100I probably damaging Het
Msx3 T A 7: 139,628,659 (GRCm39) probably benign Het
Mttp C A 3: 137,812,999 (GRCm39) A559S probably damaging Het
Myh1 C G 11: 67,092,719 (GRCm39) D4E probably damaging Het
Or2ah1 A G 2: 85,654,134 (GRCm39) K273R probably damaging Het
Or4c116 G T 2: 88,942,640 (GRCm39) T72N possibly damaging Het
Or4k45 C T 2: 111,395,252 (GRCm39) C179Y probably damaging Het
Or52e19 A T 7: 102,959,561 (GRCm39) D211V probably damaging Het
Pcdhac1 T C 18: 37,223,381 (GRCm39) Y65H probably damaging Het
Pcdhga8 A T 18: 37,860,315 (GRCm39) Y457F probably damaging Het
Pi4ka A G 16: 17,194,846 (GRCm39) L184P possibly damaging Het
Pja2 A T 17: 64,596,962 (GRCm39) M514K probably damaging Het
Plcxd2 T C 16: 45,792,488 (GRCm39) N284D probably damaging Het
Polr3d A T 14: 70,678,577 (GRCm39) M129K probably benign Het
Prdm2 G A 4: 142,859,471 (GRCm39) T1273M possibly damaging Het
Prelid2 A G 18: 42,045,514 (GRCm39) I132T possibly damaging Het
Sergef G A 7: 46,282,091 (GRCm39) probably null Het
Slc24a2 C A 4: 87,145,119 (GRCm39) probably null Het
Stxbp3 A T 3: 108,734,916 (GRCm39) D24E possibly damaging Het
Tas2r123 A T 6: 132,824,801 (GRCm39) M233L probably damaging Het
Thsd7a G A 6: 12,555,630 (GRCm39) H85Y possibly damaging Het
Tlr2 T A 3: 83,745,603 (GRCm39) E160V probably benign Het
Tmem171 A T 13: 98,828,678 (GRCm39) C157* probably null Het
Trpm3 T C 19: 22,903,392 (GRCm39) Y1051H probably damaging Het
Vmn2r28 A G 7: 5,491,408 (GRCm39) F280L probably benign Het
Xpo7 A T 14: 70,914,253 (GRCm39) Y748N probably damaging Het
Zan T C 5: 137,436,782 (GRCm39) S2024G unknown Het
Zfhx2 A T 14: 55,301,539 (GRCm39) Y2148* probably null Het
Zscan4-ps1 T C 7: 10,799,906 (GRCm39) T328A probably benign Het
Other mutations in Ppp1r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Ppp1r42 APN 1 10,073,458 (GRCm39) critical splice donor site probably null
IGL02739:Ppp1r42 APN 1 10,039,078 (GRCm39) missense probably benign 0.34
G1patch:Ppp1r42 UTSW 1 10,069,732 (GRCm39) missense probably damaging 1.00
R0920:Ppp1r42 UTSW 1 10,069,750 (GRCm39) missense probably damaging 1.00
R1829:Ppp1r42 UTSW 1 10,070,311 (GRCm39) missense probably benign 0.00
R2151:Ppp1r42 UTSW 1 10,073,572 (GRCm39) missense probably benign 0.10
R2909:Ppp1r42 UTSW 1 10,073,637 (GRCm39) intron probably benign
R4828:Ppp1r42 UTSW 1 10,069,636 (GRCm39) missense probably benign
R4863:Ppp1r42 UTSW 1 10,073,611 (GRCm39) intron probably benign
R5384:Ppp1r42 UTSW 1 10,069,660 (GRCm39) missense probably damaging 1.00
R5394:Ppp1r42 UTSW 1 10,069,630 (GRCm39) missense probably damaging 1.00
R7343:Ppp1r42 UTSW 1 10,039,082 (GRCm39) missense probably benign
R7556:Ppp1r42 UTSW 1 10,065,408 (GRCm39) missense probably benign 0.01
R8722:Ppp1r42 UTSW 1 10,055,894 (GRCm39) missense probably benign 0.15
R9477:Ppp1r42 UTSW 1 10,055,854 (GRCm39) missense probably damaging 1.00
R9612:Ppp1r42 UTSW 1 10,039,067 (GRCm39) missense possibly damaging 0.79
R9668:Ppp1r42 UTSW 1 10,073,563 (GRCm39) missense probably benign 0.42
R9752:Ppp1r42 UTSW 1 10,073,674 (GRCm39) intron probably benign
Z1177:Ppp1r42 UTSW 1 10,069,652 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTACATCCTCGGCTCTC -3'
(R):5'- TTGTGACCCTCTGGAGAGTTCG -3'

Sequencing Primer
(F):5'- CGGCTCTCCTGCTCCAC -3'
(R):5'- GAACTCTGGGATTACCTACGC -3'
Posted On 2018-08-01