Incidental Mutation 'R6725:Gal3st2'
ID529794
Institutional Source Beutler Lab
Gene Symbol Gal3st2
Ensembl Gene ENSMUSG00000094651
Gene Namegalactose-3-O-sulfotransferase 2
SynonymsLOC381334
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6725 (G1)
Quality Score194.009
Status Validated
Chromosome1
Chromosomal Location93861306-93876494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93873702 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 27 (S27T)
Ref Sequence ENSEMBL: ENSMUSP00000140697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094663] [ENSMUST00000187896]
Predicted Effect probably benign
Transcript: ENSMUST00000094663
AA Change: S76T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000092250
Gene: ENSMUSG00000094651
AA Change: S76T

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 382 1.3e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187896
AA Change: S27T

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140697
Gene: ENSMUSG00000094651
AA Change: S27T

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 67 2.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190710
Meta Mutation Damage Score 0.1522 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,743,201 Y623C probably damaging Het
Adgrv1 T C 13: 81,437,557 E4596G probably damaging Het
Adgrv1 A T 13: 81,493,210 C3267S probably damaging Het
Ankrd40 T G 11: 94,334,815 V224G probably benign Het
Ap3s2 C T 7: 79,920,642 probably benign Het
Apip T A 2: 103,092,525 D229E possibly damaging Het
Atp2b4 C T 1: 133,706,987 R1168H probably benign Het
Bcan T C 3: 87,995,484 K329R possibly damaging Het
Camk1g T C 1: 193,350,320 D261G possibly damaging Het
Ccdc30 T A 4: 119,331,599 Q490L probably damaging Het
Ccdc83 A G 7: 90,247,053 W103R probably damaging Het
Ctsl T A 13: 64,366,623 R69* probably null Het
Dchs1 C T 7: 105,758,793 R1944H probably damaging Het
Fgb T C 3: 83,043,791 Y305C probably damaging Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Galnt13 A G 2: 54,855,232 D228G probably damaging Het
Gk5 A T 9: 96,155,470 T346S probably benign Het
Gnrhr T C 5: 86,185,313 I233V probably damaging Het
Greb1 T C 12: 16,688,567 Y1465C probably damaging Het
H6pd A G 4: 149,996,358 L10P probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ighv7-4 A T 12: 114,222,869 D94E probably damaging Het
Lamb3 T C 1: 193,304,582 Y59H probably benign Het
Msantd1 C T 5: 34,921,421 T100I probably damaging Het
Msx3 T A 7: 140,048,746 probably benign Het
Mttp C A 3: 138,107,238 A559S probably damaging Het
Myh1 C G 11: 67,201,893 D4E probably damaging Het
Olfr1018 A G 2: 85,823,790 K273R probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1295 C T 2: 111,564,907 C179Y probably damaging Het
Olfr596 A T 7: 103,310,354 D211V probably damaging Het
Pcdhac1 T C 18: 37,090,328 Y65H probably damaging Het
Pcdhga8 A T 18: 37,727,262 Y457F probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pja2 A T 17: 64,289,967 M514K probably damaging Het
Plcxd2 T C 16: 45,972,125 N284D probably damaging Het
Polr3d A T 14: 70,441,137 M129K probably benign Het
Ppp1r42 T G 1: 9,999,507 E110A probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prelid2 A G 18: 41,912,449 I132T possibly damaging Het
Sergef G A 7: 46,632,667 probably null Het
Slc24a2 C A 4: 87,226,882 probably null Het
Stxbp3 A T 3: 108,827,600 D24E possibly damaging Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Thsd7a G A 6: 12,555,631 H85Y possibly damaging Het
Tlr2 T A 3: 83,838,296 E160V probably benign Het
Tmem171 A T 13: 98,692,170 C157* probably null Het
Trpm3 T C 19: 22,926,028 Y1051H probably damaging Het
Vmn2r28 A G 7: 5,488,409 F280L probably benign Het
Xpo7 A T 14: 70,676,813 Y748N probably damaging Het
Zan T C 5: 137,438,520 S2024G unknown Het
Zfhx2 A T 14: 55,064,082 Y2148* probably null Het
Zscan4-ps1 T C 7: 11,065,979 T328A probably benign Het
Other mutations in Gal3st2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02066:Gal3st2 APN 1 93873657 missense probably damaging 1.00
R1671:Gal3st2 UTSW 1 93873678 missense probably damaging 1.00
R1738:Gal3st2 UTSW 1 93874596 unclassified probably null
R4688:Gal3st2 UTSW 1 93872523 missense probably damaging 0.97
R5873:Gal3st2 UTSW 1 93873750 missense probably benign 0.03
R5985:Gal3st2 UTSW 1 93873613 missense possibly damaging 0.70
R7009:Gal3st2 UTSW 1 93873759 missense probably benign 0.01
R7067:Gal3st2 UTSW 1 93874725 missense possibly damaging 0.82
R7452:Gal3st2 UTSW 1 93872518 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CATGTCAAGGGGTACTTCTTGG -3'
(R):5'- CCAAAGCACTGCAGCTCTAG -3'

Sequencing Primer
(F):5'- CAAGGGGTACTTCTTGGGGGTG -3'
(R):5'- TGCAGCTCTAGCCCCAC -3'
Posted On2018-08-01