Incidental Mutation 'R6725:Atp2b4'
ID529795
Institutional Source Beutler Lab
Gene Symbol Atp2b4
Ensembl Gene ENSMUSG00000026463
Gene NameATPase, Ca++ transporting, plasma membrane 4
SynonymsPMCA4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R6725 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location133699457-133801041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133706987 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1168 (R1168H)
Ref Sequence ENSEMBL: ENSMUSP00000116941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048953] [ENSMUST00000125659] [ENSMUST00000143567] [ENSMUST00000165602]
Predicted Effect probably benign
Transcript: ENSMUST00000048953
SMART Domains Protein: ENSMUSP00000047978
Gene: ENSMUSG00000026463

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.7e-58 PFAM
Pfam:Hydrolase 460 798 3e-26 PFAM
Pfam:HAD 463 795 7.4e-15 PFAM
Pfam:Hydrolase_like2 510 605 3.6e-17 PFAM
Pfam:Hydrolase_3 756 831 2.7e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1153 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125659
AA Change: R1168H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000116941
Gene: ENSMUSG00000026463
AA Change: R1168H

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.7e-58 PFAM
Pfam:Hydrolase 460 798 3e-26 PFAM
Pfam:HAD 463 795 7.4e-15 PFAM
Pfam:Hydrolase_like2 510 605 3.6e-17 PFAM
Pfam:Hydrolase_3 756 831 2.7e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1153 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143567
AA Change: V1108I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119242
Gene: ENSMUSG00000026463
AA Change: V1108I

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 153 301 6.8e-29 PFAM
Pfam:E1-E2_ATPase 338 455 1.9e-13 PFAM
Pfam:HAD 463 795 1e-21 PFAM
Pfam:Cation_ATPase 509 605 5.8e-17 PFAM
Pfam:Hydrolase 577 798 5e-15 PFAM
Pfam:Hydrolase_3 756 831 6.6e-7 PFAM
Pfam:Cation_ATPase_C 868 1050 4.5e-45 PFAM
Pfam:ATP_Ca_trans_C 1090 1141 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165602
AA Change: V1108I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000133187
Gene: ENSMUSG00000026463
AA Change: V1108I

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.5e-58 PFAM
Pfam:Hydrolase 460 798 1.4e-26 PFAM
Pfam:HAD 463 795 4.1e-15 PFAM
Pfam:Hydrolase_like2 510 605 5.1e-17 PFAM
Pfam:Hydrolase_3 756 831 1e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.3e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1151 4.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 4. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility with impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,743,201 Y623C probably damaging Het
Adgrv1 T C 13: 81,437,557 E4596G probably damaging Het
Adgrv1 A T 13: 81,493,210 C3267S probably damaging Het
Ankrd40 T G 11: 94,334,815 V224G probably benign Het
Ap3s2 C T 7: 79,920,642 probably benign Het
Apip T A 2: 103,092,525 D229E possibly damaging Het
Bcan T C 3: 87,995,484 K329R possibly damaging Het
Camk1g T C 1: 193,350,320 D261G possibly damaging Het
Ccdc30 T A 4: 119,331,599 Q490L probably damaging Het
Ccdc83 A G 7: 90,247,053 W103R probably damaging Het
Ctsl T A 13: 64,366,623 R69* probably null Het
Dchs1 C T 7: 105,758,793 R1944H probably damaging Het
Fgb T C 3: 83,043,791 Y305C probably damaging Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Gal3st2 T A 1: 93,873,702 S27T probably benign Het
Galnt13 A G 2: 54,855,232 D228G probably damaging Het
Gk5 A T 9: 96,155,470 T346S probably benign Het
Gnrhr T C 5: 86,185,313 I233V probably damaging Het
Greb1 T C 12: 16,688,567 Y1465C probably damaging Het
H6pd A G 4: 149,996,358 L10P probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ighv7-4 A T 12: 114,222,869 D94E probably damaging Het
Lamb3 T C 1: 193,304,582 Y59H probably benign Het
Msantd1 C T 5: 34,921,421 T100I probably damaging Het
Msx3 T A 7: 140,048,746 probably benign Het
Mttp C A 3: 138,107,238 A559S probably damaging Het
Myh1 C G 11: 67,201,893 D4E probably damaging Het
Olfr1018 A G 2: 85,823,790 K273R probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1295 C T 2: 111,564,907 C179Y probably damaging Het
Olfr596 A T 7: 103,310,354 D211V probably damaging Het
Pcdhac1 T C 18: 37,090,328 Y65H probably damaging Het
Pcdhga8 A T 18: 37,727,262 Y457F probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pja2 A T 17: 64,289,967 M514K probably damaging Het
Plcxd2 T C 16: 45,972,125 N284D probably damaging Het
Polr3d A T 14: 70,441,137 M129K probably benign Het
Ppp1r42 T G 1: 9,999,507 E110A probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prelid2 A G 18: 41,912,449 I132T possibly damaging Het
Sergef G A 7: 46,632,667 probably null Het
Slc24a2 C A 4: 87,226,882 probably null Het
Stxbp3 A T 3: 108,827,600 D24E possibly damaging Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Thsd7a G A 6: 12,555,631 H85Y possibly damaging Het
Tlr2 T A 3: 83,838,296 E160V probably benign Het
Tmem171 A T 13: 98,692,170 C157* probably null Het
Trpm3 T C 19: 22,926,028 Y1051H probably damaging Het
Vmn2r28 A G 7: 5,488,409 F280L probably benign Het
Xpo7 A T 14: 70,676,813 Y748N probably damaging Het
Zan T C 5: 137,438,520 S2024G unknown Het
Zfhx2 A T 14: 55,064,082 Y2148* probably null Het
Zscan4-ps1 T C 7: 11,065,979 T328A probably benign Het
Other mutations in Atp2b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Atp2b4 APN 1 133731889 missense probably damaging 1.00
IGL02887:Atp2b4 APN 1 133728774 missense probably damaging 1.00
IGL02964:Atp2b4 APN 1 133730565 missense probably damaging 1.00
IGL03116:Atp2b4 APN 1 133728768 missense possibly damaging 0.95
IGL03227:Atp2b4 APN 1 133729707 splice site probably benign
R0018:Atp2b4 UTSW 1 133717871 missense probably damaging 1.00
R0018:Atp2b4 UTSW 1 133717871 missense probably damaging 1.00
R0279:Atp2b4 UTSW 1 133729702 splice site probably benign
R0455:Atp2b4 UTSW 1 133728716 missense probably damaging 1.00
R0511:Atp2b4 UTSW 1 133732218 splice site probably benign
R0712:Atp2b4 UTSW 1 133730478 missense probably damaging 1.00
R1469:Atp2b4 UTSW 1 133706939 missense probably damaging 0.97
R1469:Atp2b4 UTSW 1 133706939 missense probably damaging 0.97
R1529:Atp2b4 UTSW 1 133717988 missense probably damaging 1.00
R1771:Atp2b4 UTSW 1 133732393 missense probably damaging 0.96
R1954:Atp2b4 UTSW 1 133739992 missense probably damaging 1.00
R2054:Atp2b4 UTSW 1 133715169 missense probably benign 0.03
R2056:Atp2b4 UTSW 1 133726537 missense probably benign 0.36
R2059:Atp2b4 UTSW 1 133726537 missense probably benign 0.36
R2091:Atp2b4 UTSW 1 133715230 missense probably benign 0.00
R2263:Atp2b4 UTSW 1 133726533 missense probably benign 0.35
R3907:Atp2b4 UTSW 1 133738586 missense probably damaging 1.00
R4362:Atp2b4 UTSW 1 133739931 missense possibly damaging 0.94
R4756:Atp2b4 UTSW 1 133711791 missense probably benign 0.00
R4756:Atp2b4 UTSW 1 133739396 missense probably benign 0.41
R4856:Atp2b4 UTSW 1 133706780 missense probably benign 0.00
R4886:Atp2b4 UTSW 1 133706780 missense probably benign 0.00
R5177:Atp2b4 UTSW 1 133728768 missense probably benign 0.00
R5454:Atp2b4 UTSW 1 133729872 missense probably damaging 1.00
R5594:Atp2b4 UTSW 1 133730510 missense probably damaging 1.00
R5712:Atp2b4 UTSW 1 133730540 missense probably damaging 1.00
R6034:Atp2b4 UTSW 1 133731907 critical splice acceptor site probably null
R6034:Atp2b4 UTSW 1 133731907 critical splice acceptor site probably null
R6078:Atp2b4 UTSW 1 133701702 small insertion probably benign
R6079:Atp2b4 UTSW 1 133701702 small insertion probably benign
R6244:Atp2b4 UTSW 1 133726561 missense probably damaging 1.00
R6376:Atp2b4 UTSW 1 133715059 missense probably damaging 1.00
R6483:Atp2b4 UTSW 1 133729880 missense possibly damaging 0.68
R6526:Atp2b4 UTSW 1 133711729 missense probably damaging 0.99
R6801:Atp2b4 UTSW 1 133727786 missense probably damaging 0.97
R7548:Atp2b4 UTSW 1 133701641 makesense probably null
R8228:Atp2b4 UTSW 1 133701721 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GCTTCACCATCCAACAGGAG -3'
(R):5'- TGGAATGTAACCTTTGAGACATCCTC -3'

Sequencing Primer
(F):5'- AGGAGCACACTCGTCCC -3'
(R):5'- ACGCCCTGTGCTTGAGATC -3'
Posted On2018-08-01