Incidental Mutation 'R6725:Olfr1221'
ID529800
Institutional Source Beutler Lab
Gene Symbol Olfr1221
Ensembl Gene ENSMUSG00000075102
Gene Nameolfactory receptor 1221
SynonymsGA_x6K02T2Q125-50591144-50590209, MOR233-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6725 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89109086-89117283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89112296 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 72 (T72N)
Ref Sequence ENSEMBL: ENSMUSP00000149330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099795] [ENSMUST00000143255] [ENSMUST00000213404] [ENSMUST00000217635]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099795
AA Change: T72N

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097383
Gene: ENSMUSG00000075102
AA Change: T72N

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.6e-48 PFAM
Pfam:7tm_1 39 302 3.6e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143255
AA Change: T72N

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213404
AA Change: T72N

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217635
AA Change: T72N

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,743,201 Y623C probably damaging Het
Adgrv1 T C 13: 81,437,557 E4596G probably damaging Het
Adgrv1 A T 13: 81,493,210 C3267S probably damaging Het
Ankrd40 T G 11: 94,334,815 V224G probably benign Het
Ap3s2 C T 7: 79,920,642 probably benign Het
Apip T A 2: 103,092,525 D229E possibly damaging Het
Atp2b4 C T 1: 133,706,987 R1168H probably benign Het
Bcan T C 3: 87,995,484 K329R possibly damaging Het
Camk1g T C 1: 193,350,320 D261G possibly damaging Het
Ccdc30 T A 4: 119,331,599 Q490L probably damaging Het
Ccdc83 A G 7: 90,247,053 W103R probably damaging Het
Ctsl T A 13: 64,366,623 R69* probably null Het
Dchs1 C T 7: 105,758,793 R1944H probably damaging Het
Fgb T C 3: 83,043,791 Y305C probably damaging Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Gal3st2 T A 1: 93,873,702 S27T probably benign Het
Galnt13 A G 2: 54,855,232 D228G probably damaging Het
Gk5 A T 9: 96,155,470 T346S probably benign Het
Gnrhr T C 5: 86,185,313 I233V probably damaging Het
Greb1 T C 12: 16,688,567 Y1465C probably damaging Het
H6pd A G 4: 149,996,358 L10P probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ighv7-4 A T 12: 114,222,869 D94E probably damaging Het
Lamb3 T C 1: 193,304,582 Y59H probably benign Het
Msantd1 C T 5: 34,921,421 T100I probably damaging Het
Msx3 T A 7: 140,048,746 probably benign Het
Mttp C A 3: 138,107,238 A559S probably damaging Het
Myh1 C G 11: 67,201,893 D4E probably damaging Het
Olfr1018 A G 2: 85,823,790 K273R probably damaging Het
Olfr1295 C T 2: 111,564,907 C179Y probably damaging Het
Olfr596 A T 7: 103,310,354 D211V probably damaging Het
Pcdhac1 T C 18: 37,090,328 Y65H probably damaging Het
Pcdhga8 A T 18: 37,727,262 Y457F probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pja2 A T 17: 64,289,967 M514K probably damaging Het
Plcxd2 T C 16: 45,972,125 N284D probably damaging Het
Polr3d A T 14: 70,441,137 M129K probably benign Het
Ppp1r42 T G 1: 9,999,507 E110A probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prelid2 A G 18: 41,912,449 I132T possibly damaging Het
Sergef G A 7: 46,632,667 probably null Het
Slc24a2 C A 4: 87,226,882 probably null Het
Stxbp3 A T 3: 108,827,600 D24E possibly damaging Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Thsd7a G A 6: 12,555,631 H85Y possibly damaging Het
Tlr2 T A 3: 83,838,296 E160V probably benign Het
Tmem171 A T 13: 98,692,170 C157* probably null Het
Trpm3 T C 19: 22,926,028 Y1051H probably damaging Het
Vmn2r28 A G 7: 5,488,409 F280L probably benign Het
Xpo7 A T 14: 70,676,813 Y748N probably damaging Het
Zan T C 5: 137,438,520 S2024G unknown Het
Zfhx2 A T 14: 55,064,082 Y2148* probably null Het
Zscan4-ps1 T C 7: 11,065,979 T328A probably benign Het
Other mutations in Olfr1221
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Olfr1221 APN 2 89111679 missense probably benign 0.19
IGL01965:Olfr1221 APN 2 89112191 missense probably benign 0.37
IGL02645:Olfr1221 APN 2 89111619 missense probably benign 0.00
PIT4354001:Olfr1221 UTSW 2 89112486 nonsense probably null
R0124:Olfr1221 UTSW 2 89111744 missense possibly damaging 0.56
R0940:Olfr1221 UTSW 2 89112075 missense probably benign
R3689:Olfr1221 UTSW 2 89112042 missense possibly damaging 0.85
R4489:Olfr1221 UTSW 2 89111572 splice site probably null
R4706:Olfr1221 UTSW 2 89112232 missense probably damaging 0.98
R4707:Olfr1221 UTSW 2 89112232 missense probably damaging 0.98
R5133:Olfr1221 UTSW 2 89111796 splice site probably null
R6629:Olfr1221 UTSW 2 89112162 missense probably benign 0.09
R6644:Olfr1221 UTSW 2 89111981 missense probably benign 0.00
R6723:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6754:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6765:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6766:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R7215:Olfr1221 UTSW 2 89112501 nonsense probably null
R7562:Olfr1221 UTSW 2 89112285 missense probably benign 0.00
R7681:Olfr1221 UTSW 2 89111591 missense probably benign 0.00
R7981:Olfr1221 UTSW 2 89112056 missense probably damaging 1.00
R8318:Olfr1221 UTSW 2 89111898 missense probably benign 0.02
R8425:Olfr1221 UTSW 2 89112393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCATAATGGACAGGTAGTGC -3'
(R):5'- TCAAAGCCTTGTCAATGAGTTC -3'

Sequencing Primer
(F):5'- CAAGGGTTTGCAAATAGCCAC -3'
(R):5'- GAGTTCATACTCCTGGGTCTTTC -3'
Posted On2018-08-01