Mutagenetix > Incidental Mutation

Incidental Mutation 'R6725:Mttp'

529807

Institutional Source

Beutler Lab

Gene Symbol

Mttp

Ensembl Gene

ENSMUSG00000028158

Gene Name

microsomal triglyceride transfer protein

Synonyms

1810043K16Rik, MTP

MMRRC Submission

044843-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.835) question?

Stock #

R6725 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

138089854-138144968 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 138107238 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 559 (A559S)

Ref Sequence

ENSEMBL: ENSMUSP00000096179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029805] [ENSMUST00000098580]

AlphaFold

O08601

Predicted Effect

probably damaging
Transcript: ENSMUST00000029805
AA Change: A544S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029805
Gene: ENSMUSG00000028158
AA Change: A544S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
LPD_N	28	579	8.87e-165	SMART
Blast:LPD_N	582	695	4e-58	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000098580
AA Change: A559S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096179
Gene: ENSMUSG00000028158
AA Change: A559S

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
LPD_N	43	594	8.87e-165	SMART
Blast:LPD_N	597	710	6e-58	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196625

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a reporter allele die at midgestation displaying delayed growth, neurodevelopmental anomalies, impaired erythropoiesis, deficient yolk sac lipoprotein production, hemorrhage and necrosis. Heterozygous mutant mice display altered plasma lipid and lipoprotein profiles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts18	T	C	8: 113,743,201	Y623C	probably damaging	Het
Adgrv1	T	C	13: 81,437,557	E4596G	probably damaging	Het
Adgrv1	A	T	13: 81,493,210	C3267S	probably damaging	Het
Ankrd40	T	G	11: 94,334,815	V224G	probably benign	Het
Ap3s2	C	T	7: 79,920,642		probably benign	Het
Apip	T	A	2: 103,092,525	D229E	possibly damaging	Het
Atp2b4	C	T	1: 133,706,987	R1168H	probably benign	Het
Bcan	T	C	3: 87,995,484	K329R	possibly damaging	Het
Camk1g	T	C	1: 193,350,320	D261G	possibly damaging	Het
Ccdc30	T	A	4: 119,331,599	Q490L	probably damaging	Het
Ccdc83	A	G	7: 90,247,053	W103R	probably damaging	Het
Ctsl	T	A	13: 64,366,623	R69*	probably null	Het
Dchs1	C	T	7: 105,758,793	R1944H	probably damaging	Het
Fgb	T	C	3: 83,043,791	Y305C	probably damaging	Het
Fras1	T	A	5: 96,781,340	Y3868N	possibly damaging	Het
Gal3st2	T	A	1: 93,873,702	S27T	probably benign	Het
Galnt13	A	G	2: 54,855,232	D228G	probably damaging	Het
Gk5	A	T	9: 96,155,470	T346S	probably benign	Het
Gnrhr	T	C	5: 86,185,313	I233V	probably damaging	Het
Greb1	T	C	12: 16,688,567	Y1465C	probably damaging	Het
H6pd	A	G	4: 149,996,358	L10P	probably damaging	Het
Hspg2	G	A	4: 137,515,307	G611E	probably damaging	Het
Ighv7-4	A	T	12: 114,222,869	D94E	probably damaging	Het
Lamb3	T	C	1: 193,304,582	Y59H	probably benign	Het
Msantd1	C	T	5: 34,921,421	T100I	probably damaging	Het
Msx3	T	A	7: 140,048,746		probably benign	Het
Myh1	C	G	11: 67,201,893	D4E	probably damaging	Het
Olfr1018	A	G	2: 85,823,790	K273R	probably damaging	Het
Olfr1221	G	T	2: 89,112,296	T72N	possibly damaging	Het
Olfr1295	C	T	2: 111,564,907	C179Y	probably damaging	Het
Olfr596	A	T	7: 103,310,354	D211V	probably damaging	Het
Pcdhac1	T	C	18: 37,090,328	Y65H	probably damaging	Het
Pcdhga8	A	T	18: 37,727,262	Y457F	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Pja2	A	T	17: 64,289,967	M514K	probably damaging	Het
Plcxd2	T	C	16: 45,972,125	N284D	probably damaging	Het
Polr3d	A	T	14: 70,441,137	M129K	probably benign	Het
Ppp1r42	T	G	1: 9,999,507	E110A	probably damaging	Het
Prdm2	G	A	4: 143,132,901	T1273M	possibly damaging	Het
Prelid2	A	G	18: 41,912,449	I132T	possibly damaging	Het
Sergef	G	A	7: 46,632,667		probably null	Het
Slc24a2	C	A	4: 87,226,882		probably null	Het
Stxbp3	A	T	3: 108,827,600	D24E	possibly damaging	Het
Tas2r123	A	T	6: 132,847,838	M233L	probably damaging	Het
Thsd7a	G	A	6: 12,555,631	H85Y	possibly damaging	Het
Tlr2	T	A	3: 83,838,296	E160V	probably benign	Het
Tmem171	A	T	13: 98,692,170	C157*	probably null	Het
Trpm3	T	C	19: 22,926,028	Y1051H	probably damaging	Het
Vmn2r28	A	G	7: 5,488,409	F280L	probably benign	Het
Xpo7	A	T	14: 70,676,813	Y748N	probably damaging	Het
Zan	T	C	5: 137,438,520	S2024G	unknown	Het
Zfhx2	A	T	14: 55,064,082	Y2148*	probably null	Het
Zscan4-ps1	T	C	7: 11,065,979	T328A	probably benign	Het

Other mutations in Mttp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00722:Mttp	APN	3	138109015	missense	possibly damaging	0.84
IGL00983:Mttp	APN	3	138115129	splice site	probably benign
IGL01128:Mttp	APN	3	138133997	splice site	probably null
IGL01607:Mttp	APN	3	138104698	missense	probably damaging	0.99
IGL01760:Mttp	APN	3	138111736	missense	probably benign	0.00
IGL01947:Mttp	APN	3	138107129	missense	probably damaging	1.00
IGL02184:Mttp	APN	3	138116000	critical splice donor site	probably null
IGL02932:Mttp	APN	3	138111744	missense	probably benign	0.07
IGL02957:Mttp	APN	3	138109081	missense	possibly damaging	0.95
IGL03082:Mttp	APN	3	138123795	missense	probably benign	0.01
IGL03302:Mttp	APN	3	138104707	missense	possibly damaging	0.90
IGL03381:Mttp	APN	3	138104943	missense	probably damaging	1.00
G1patch:Mttp	UTSW	3	138107238	missense	probably damaging	1.00
P0040:Mttp	UTSW	3	138112566	missense	possibly damaging	0.82
R0543:Mttp	UTSW	3	138111696	missense	possibly damaging	0.75
R0738:Mttp	UTSW	3	138103313	missense	probably damaging	1.00
R0967:Mttp	UTSW	3	138092723	missense	probably benign	0.00
R1281:Mttp	UTSW	3	138107219	missense	possibly damaging	0.95
R1565:Mttp	UTSW	3	138116405	critical splice donor site	probably null
R1660:Mttp	UTSW	3	138103193	missense	probably damaging	1.00
R1828:Mttp	UTSW	3	138107280	missense	probably damaging	1.00
R1886:Mttp	UTSW	3	138092615	missense	probably damaging	1.00
R1912:Mttp	UTSW	3	138116027	missense	probably benign	0.01
R1938:Mttp	UTSW	3	138125121	missense	probably benign	0.21
R2020:Mttp	UTSW	3	138118402	missense	probably damaging	0.98
R2109:Mttp	UTSW	3	138095002	missense	probably benign	0.27
R2336:Mttp	UTSW	3	138116095	missense	possibly damaging	0.81
R2392:Mttp	UTSW	3	138095021	missense	probably damaging	0.98
R3021:Mttp	UTSW	3	138111703	missense	probably benign
R3774:Mttp	UTSW	3	138114263	splice site	probably null
R3776:Mttp	UTSW	3	138114263	splice site	probably null
R4687:Mttp	UTSW	3	138092735	missense	possibly damaging	0.66
R4708:Mttp	UTSW	3	138134098	unclassified	probably benign
R4756:Mttp	UTSW	3	138116071	missense	possibly damaging	0.77
R4832:Mttp	UTSW	3	138116050	missense	probably benign
R5377:Mttp	UTSW	3	138105029	missense	probably benign	0.03
R5670:Mttp	UTSW	3	138125113	missense	probably damaging	0.99
R6613:Mttp	UTSW	3	138109078	missense	probably damaging	1.00
R6799:Mttp	UTSW	3	138095080	missense	probably benign	0.04
R6920:Mttp	UTSW	3	138115282	missense	possibly damaging	0.49
R7074:Mttp	UTSW	3	138107273	missense	possibly damaging	0.53
R7131:Mttp	UTSW	3	138116132	missense	probably benign	0.13
R7275:Mttp	UTSW	3	138123785	missense	probably benign	0.19
R7291:Mttp	UTSW	3	138091203	missense	probably damaging	1.00
R7310:Mttp	UTSW	3	138095022	missense	probably damaging	1.00
R7769:Mttp	UTSW	3	138103112	missense	probably damaging	1.00
R7909:Mttp	UTSW	3	138118417	nonsense	probably null
R8037:Mttp	UTSW	3	138091122	missense	probably damaging	1.00
R8220:Mttp	UTSW	3	138123848	missense	probably benign	0.00
R8335:Mttp	UTSW	3	138103212	missense	possibly damaging	0.90
R8352:Mttp	UTSW	3	138112613	missense	probably damaging	1.00
R8452:Mttp	UTSW	3	138112613	missense	probably damaging	1.00
R8536:Mttp	UTSW	3	138104943	missense	probably damaging	1.00
R8677:Mttp	UTSW	3	138104676	missense	probably benign	0.00
R8877:Mttp	UTSW	3	138112556	missense	probably damaging	0.99
R9233:Mttp	UTSW	3	138116519	missense	probably damaging	1.00
R9237:Mttp	UTSW	3	138104683	missense	probably benign
R9427:Mttp	UTSW	3	138115201	missense	probably benign	0.01
R9749:Mttp	UTSW	3	138125228	missense	probably damaging	0.99
R9797:Mttp	UTSW	3	138108964	missense	probably damaging	0.96
Z1176:Mttp	UTSW	3	138104779	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGGCACCACGTCAATATTCAG -3'
(R):5'- CCCAGAGGGTGAAACTCATATAC -3'

Sequencing Primer
(F):5'- CCACGTCAATATTCAGATAGGCTTGC -3'
(R):5'- ACATCAAGGTTGGTCACAGTC -3'

Posted On

2018-08-01