Incidental Mutation 'R6725:H6pd'
ID529812
Institutional Source Beutler Lab
Gene Symbol H6pd
Ensembl Gene ENSMUSG00000028980
Gene Namehexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
SynonymsGpd-1, Gpd1, G6pd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6725 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location149979475-150009023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149996358 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 10 (L10P)
Ref Sequence ENSEMBL: ENSMUSP00000030830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030830] [ENSMUST00000084117] [ENSMUST00000153394]
Predicted Effect probably damaging
Transcript: ENSMUST00000030830
AA Change: L10P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030830
Gene: ENSMUSG00000028980
AA Change: L10P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:G6PD_N 34 218 1.6e-41 PFAM
Pfam:G6PD_C 220 523 3.2e-58 PFAM
Pfam:Glucosamine_iso 564 788 8.2e-66 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000084117
AA Change: L2P
SMART Domains Protein: ENSMUSP00000081134
Gene: ENSMUSG00000028980
AA Change: L2P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:G6PD_N 26 210 8.6e-39 PFAM
Pfam:G6PD_C 212 387 3.6e-42 PFAM
Pfam:Glucosamine_iso 561 758 9.9e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152907
Predicted Effect unknown
Transcript: ENSMUST00000153394
AA Change: L2P
SMART Domains Protein: ENSMUSP00000115647
Gene: ENSMUSG00000028980
AA Change: L2P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:G6PD_N 26 172 5e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show enlarged adrenal glands, reduced plasma corticosterone levels and altered 11 beta-hydroxysteroid dehydrogenase type 1 enzyme activity. Treatment with 11-dehydrocorticosterone fails to inhibit glucose-stimulatedinsulin secretion in pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,743,201 Y623C probably damaging Het
Adgrv1 T C 13: 81,437,557 E4596G probably damaging Het
Adgrv1 A T 13: 81,493,210 C3267S probably damaging Het
Ankrd40 T G 11: 94,334,815 V224G probably benign Het
Ap3s2 C T 7: 79,920,642 probably benign Het
Apip T A 2: 103,092,525 D229E possibly damaging Het
Atp2b4 C T 1: 133,706,987 R1168H probably benign Het
Bcan T C 3: 87,995,484 K329R possibly damaging Het
Camk1g T C 1: 193,350,320 D261G possibly damaging Het
Ccdc30 T A 4: 119,331,599 Q490L probably damaging Het
Ccdc83 A G 7: 90,247,053 W103R probably damaging Het
Ctsl T A 13: 64,366,623 R69* probably null Het
Dchs1 C T 7: 105,758,793 R1944H probably damaging Het
Fgb T C 3: 83,043,791 Y305C probably damaging Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Gal3st2 T A 1: 93,873,702 S27T probably benign Het
Galnt13 A G 2: 54,855,232 D228G probably damaging Het
Gk5 A T 9: 96,155,470 T346S probably benign Het
Gnrhr T C 5: 86,185,313 I233V probably damaging Het
Greb1 T C 12: 16,688,567 Y1465C probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ighv7-4 A T 12: 114,222,869 D94E probably damaging Het
Lamb3 T C 1: 193,304,582 Y59H probably benign Het
Msantd1 C T 5: 34,921,421 T100I probably damaging Het
Msx3 T A 7: 140,048,746 probably benign Het
Mttp C A 3: 138,107,238 A559S probably damaging Het
Myh1 C G 11: 67,201,893 D4E probably damaging Het
Olfr1018 A G 2: 85,823,790 K273R probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1295 C T 2: 111,564,907 C179Y probably damaging Het
Olfr596 A T 7: 103,310,354 D211V probably damaging Het
Pcdhac1 T C 18: 37,090,328 Y65H probably damaging Het
Pcdhga8 A T 18: 37,727,262 Y457F probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pja2 A T 17: 64,289,967 M514K probably damaging Het
Plcxd2 T C 16: 45,972,125 N284D probably damaging Het
Polr3d A T 14: 70,441,137 M129K probably benign Het
Ppp1r42 T G 1: 9,999,507 E110A probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prelid2 A G 18: 41,912,449 I132T possibly damaging Het
Sergef G A 7: 46,632,667 probably null Het
Slc24a2 C A 4: 87,226,882 probably null Het
Stxbp3 A T 3: 108,827,600 D24E possibly damaging Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Thsd7a G A 6: 12,555,631 H85Y possibly damaging Het
Tlr2 T A 3: 83,838,296 E160V probably benign Het
Tmem171 A T 13: 98,692,170 C157* probably null Het
Trpm3 T C 19: 22,926,028 Y1051H probably damaging Het
Vmn2r28 A G 7: 5,488,409 F280L probably benign Het
Xpo7 A T 14: 70,676,813 Y748N probably damaging Het
Zan T C 5: 137,438,520 S2024G unknown Het
Zfhx2 A T 14: 55,064,082 Y2148* probably null Het
Zscan4-ps1 T C 7: 11,065,979 T328A probably benign Het
Other mutations in H6pd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:H6pd APN 4 149994468 critical splice donor site probably null
IGL01450:H6pd APN 4 149984118 missense probably damaging 1.00
IGL01913:H6pd APN 4 149994463 unclassified probably benign
IGL01914:H6pd APN 4 149994463 unclassified probably benign
dryer UTSW 4 149982865 missense probably damaging 1.00
herr UTSW 4 149983902 critical splice donor site probably null
R0402:H6pd UTSW 4 149996316 missense probably damaging 1.00
R0486:H6pd UTSW 4 149982936 splice site probably benign
R0548:H6pd UTSW 4 149981616 missense probably damaging 1.00
R0690:H6pd UTSW 4 149982573 missense possibly damaging 0.93
R1165:H6pd UTSW 4 149995956 missense possibly damaging 0.95
R1298:H6pd UTSW 4 149982514 missense probably benign 0.01
R1331:H6pd UTSW 4 149982415 missense probably benign 0.28
R1581:H6pd UTSW 4 149982514 missense possibly damaging 0.94
R1781:H6pd UTSW 4 149995931 missense probably damaging 1.00
R1791:H6pd UTSW 4 149981673 missense probably damaging 0.97
R1840:H6pd UTSW 4 149982050 missense possibly damaging 0.55
R2290:H6pd UTSW 4 149981881 missense probably damaging 1.00
R3889:H6pd UTSW 4 149995773 missense possibly damaging 0.67
R4432:H6pd UTSW 4 149995758 missense probably damaging 1.00
R4576:H6pd UTSW 4 149994476 missense probably damaging 0.99
R4629:H6pd UTSW 4 149996346 missense probably benign 0.10
R4856:H6pd UTSW 4 149982778 missense possibly damaging 0.47
R4886:H6pd UTSW 4 149982778 missense possibly damaging 0.47
R4951:H6pd UTSW 4 149981587 missense probably damaging 1.00
R5124:H6pd UTSW 4 149982055 missense possibly damaging 0.57
R5337:H6pd UTSW 4 149981784 missense probably benign 0.02
R5408:H6pd UTSW 4 149982865 missense probably damaging 1.00
R5474:H6pd UTSW 4 149996089 missense probably damaging 1.00
R6266:H6pd UTSW 4 149995957 missense probably benign 0.32
R6476:H6pd UTSW 4 149982727 missense probably damaging 0.99
R6733:H6pd UTSW 4 149985121 intron probably null
R6785:H6pd UTSW 4 149982790 missense possibly damaging 0.50
R6853:H6pd UTSW 4 149982462 missense probably benign 0.00
R6921:H6pd UTSW 4 149982051 missense probably damaging 0.99
R7258:H6pd UTSW 4 149996362 missense probably benign 0.09
R7269:H6pd UTSW 4 149982912 missense probably benign 0.00
R7326:H6pd UTSW 4 149996350 missense probably benign 0.00
R7348:H6pd UTSW 4 149983902 critical splice donor site probably null
R7488:H6pd UTSW 4 149982636 missense probably benign
R7512:H6pd UTSW 4 149995948 missense probably benign 0.00
R7684:H6pd UTSW 4 149996062 missense probably benign
R7704:H6pd UTSW 4 149982903 missense probably benign 0.45
X0020:H6pd UTSW 4 149982798 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTGGAAGCTGAAACTGTGG -3'
(R):5'- AGCTCCCGACATACTTTTGGC -3'

Sequencing Primer
(F):5'- AAGCTGAAACTGTGGCCCTTC -3'
(R):5'- CCGACATACTTTTGGCACGGAAG -3'
Posted On2018-08-01