Mutagenetix > Incidental Mutation

Incidental Mutation 'R6725:H6pd'

529812

Institutional Source

Beutler Lab

Gene Symbol

H6pd

Ensembl Gene

ENSMUSG00000028980

Gene Name

hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)

Synonyms

Gpd-1, Gpd1, G6pd1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R6725 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

149979475-150009023 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 149996358 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 10 (L10P)

Ref Sequence

ENSEMBL: ENSMUSP00000030830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030830] [ENSMUST00000084117] [ENSMUST00000153394]

AlphaFold

Q8CFX1

Predicted Effect

probably damaging
Transcript: ENSMUST00000030830
AA Change: L10P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030830
Gene: ENSMUSG00000028980
AA Change: L10P

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:G6PD_N	34	218	1.6e-41	PFAM
Pfam:G6PD_C	220	523	3.2e-58	PFAM
Pfam:Glucosamine_iso	564	788	8.2e-66	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000084117
AA Change: L2P

SMART Domains

Protein: ENSMUSP00000081134
Gene: ENSMUSG00000028980
AA Change: L2P

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:G6PD_N	26	210	8.6e-39	PFAM
Pfam:G6PD_C	212	387	3.6e-42	PFAM
Pfam:Glucosamine_iso	561	758	9.9e-62	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152907

Predicted Effect

unknown
Transcript: ENSMUST00000153394
AA Change: L2P

SMART Domains

Protein: ENSMUSP00000115647
Gene: ENSMUSG00000028980
AA Change: L2P

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:G6PD_N	26	172	5e-21	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show enlarged adrenal glands, reduced plasma corticosterone levels and altered 11 beta-hydroxysteroid dehydrogenase type 1 enzyme activity. Treatment with 11-dehydrocorticosterone fails to inhibit glucose-stimulatedinsulin secretion in pancreatic islets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts18	T	C	8: 113,743,201	Y623C	probably damaging	Het
Adgrv1	T	C	13: 81,437,557	E4596G	probably damaging	Het
Adgrv1	A	T	13: 81,493,210	C3267S	probably damaging	Het
Ankrd40	T	G	11: 94,334,815	V224G	probably benign	Het
Ap3s2	C	T	7: 79,920,642		probably benign	Het
Apip	T	A	2: 103,092,525	D229E	possibly damaging	Het
Atp2b4	C	T	1: 133,706,987	R1168H	probably benign	Het
Bcan	T	C	3: 87,995,484	K329R	possibly damaging	Het
Camk1g	T	C	1: 193,350,320	D261G	possibly damaging	Het
Ccdc30	T	A	4: 119,331,599	Q490L	probably damaging	Het
Ccdc83	A	G	7: 90,247,053	W103R	probably damaging	Het
Ctsl	T	A	13: 64,366,623	R69*	probably null	Het
Dchs1	C	T	7: 105,758,793	R1944H	probably damaging	Het
Fgb	T	C	3: 83,043,791	Y305C	probably damaging	Het
Fras1	T	A	5: 96,781,340	Y3868N	possibly damaging	Het
Gal3st2	T	A	1: 93,873,702	S27T	probably benign	Het
Galnt13	A	G	2: 54,855,232	D228G	probably damaging	Het
Gk5	A	T	9: 96,155,470	T346S	probably benign	Het
Gnrhr	T	C	5: 86,185,313	I233V	probably damaging	Het
Greb1	T	C	12: 16,688,567	Y1465C	probably damaging	Het
Hspg2	G	A	4: 137,515,307	G611E	probably damaging	Het
Ighv7-4	A	T	12: 114,222,869	D94E	probably damaging	Het
Lamb3	T	C	1: 193,304,582	Y59H	probably benign	Het
Msantd1	C	T	5: 34,921,421	T100I	probably damaging	Het
Msx3	T	A	7: 140,048,746		probably benign	Het
Mttp	C	A	3: 138,107,238	A559S	probably damaging	Het
Myh1	C	G	11: 67,201,893	D4E	probably damaging	Het
Olfr1018	A	G	2: 85,823,790	K273R	probably damaging	Het
Olfr1221	G	T	2: 89,112,296	T72N	possibly damaging	Het
Olfr1295	C	T	2: 111,564,907	C179Y	probably damaging	Het
Olfr596	A	T	7: 103,310,354	D211V	probably damaging	Het
Pcdhac1	T	C	18: 37,090,328	Y65H	probably damaging	Het
Pcdhga8	A	T	18: 37,727,262	Y457F	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Pja2	A	T	17: 64,289,967	M514K	probably damaging	Het
Plcxd2	T	C	16: 45,972,125	N284D	probably damaging	Het
Polr3d	A	T	14: 70,441,137	M129K	probably benign	Het
Ppp1r42	T	G	1: 9,999,507	E110A	probably damaging	Het
Prdm2	G	A	4: 143,132,901	T1273M	possibly damaging	Het
Prelid2	A	G	18: 41,912,449	I132T	possibly damaging	Het
Sergef	G	A	7: 46,632,667		probably null	Het
Slc24a2	C	A	4: 87,226,882		probably null	Het
Stxbp3	A	T	3: 108,827,600	D24E	possibly damaging	Het
Tas2r123	A	T	6: 132,847,838	M233L	probably damaging	Het
Thsd7a	G	A	6: 12,555,631	H85Y	possibly damaging	Het
Tlr2	T	A	3: 83,838,296	E160V	probably benign	Het
Tmem171	A	T	13: 98,692,170	C157*	probably null	Het
Trpm3	T	C	19: 22,926,028	Y1051H	probably damaging	Het
Vmn2r28	A	G	7: 5,488,409	F280L	probably benign	Het
Xpo7	A	T	14: 70,676,813	Y748N	probably damaging	Het
Zan	T	C	5: 137,438,520	S2024G	unknown	Het
Zfhx2	A	T	14: 55,064,082	Y2148*	probably null	Het
Zscan4-ps1	T	C	7: 11,065,979	T328A	probably benign	Het

Other mutations in H6pd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00916:H6pd	APN	4	149994468	critical splice donor site	probably null
IGL01450:H6pd	APN	4	149984118	missense	probably damaging	1.00
IGL01913:H6pd	APN	4	149994463	unclassified	probably benign
IGL01914:H6pd	APN	4	149994463	unclassified	probably benign
dryer	UTSW	4	149982865	missense	probably damaging	1.00
herr	UTSW	4	149983902	critical splice donor site	probably null
G1patch:H6pd	UTSW	4	149996358	missense	probably damaging	1.00
R0402:H6pd	UTSW	4	149996316	missense	probably damaging	1.00
R0486:H6pd	UTSW	4	149982936	splice site	probably benign
R0548:H6pd	UTSW	4	149981616	missense	probably damaging	1.00
R0690:H6pd	UTSW	4	149982573	missense	possibly damaging	0.93
R1165:H6pd	UTSW	4	149995956	missense	possibly damaging	0.95
R1298:H6pd	UTSW	4	149982514	missense	probably benign	0.01
R1331:H6pd	UTSW	4	149982415	missense	probably benign	0.28
R1581:H6pd	UTSW	4	149982514	missense	possibly damaging	0.94
R1781:H6pd	UTSW	4	149995931	missense	probably damaging	1.00
R1791:H6pd	UTSW	4	149981673	missense	probably damaging	0.97
R1840:H6pd	UTSW	4	149982050	missense	possibly damaging	0.55
R2290:H6pd	UTSW	4	149981881	missense	probably damaging	1.00
R3889:H6pd	UTSW	4	149995773	missense	possibly damaging	0.67
R4432:H6pd	UTSW	4	149995758	missense	probably damaging	1.00
R4576:H6pd	UTSW	4	149994476	missense	probably damaging	0.99
R4629:H6pd	UTSW	4	149996346	missense	probably benign	0.10
R4856:H6pd	UTSW	4	149982778	missense	possibly damaging	0.47
R4886:H6pd	UTSW	4	149982778	missense	possibly damaging	0.47
R4951:H6pd	UTSW	4	149981587	missense	probably damaging	1.00
R5124:H6pd	UTSW	4	149982055	missense	possibly damaging	0.57
R5337:H6pd	UTSW	4	149981784	missense	probably benign	0.02
R5408:H6pd	UTSW	4	149982865	missense	probably damaging	1.00
R5474:H6pd	UTSW	4	149996089	missense	probably damaging	1.00
R6266:H6pd	UTSW	4	149995957	missense	probably benign	0.32
R6476:H6pd	UTSW	4	149982727	missense	probably damaging	0.99
R6733:H6pd	UTSW	4	149985121	splice site	probably null
R6785:H6pd	UTSW	4	149982790	missense	possibly damaging	0.50
R6853:H6pd	UTSW	4	149982462	missense	probably benign	0.00
R6921:H6pd	UTSW	4	149982051	missense	probably damaging	0.99
R7258:H6pd	UTSW	4	149996362	missense	probably benign	0.09
R7269:H6pd	UTSW	4	149982912	missense	probably benign	0.00
R7326:H6pd	UTSW	4	149996350	missense	probably benign	0.00
R7348:H6pd	UTSW	4	149983902	critical splice donor site	probably null
R7488:H6pd	UTSW	4	149982636	missense	probably benign
R7512:H6pd	UTSW	4	149995948	missense	probably benign	0.00
R7684:H6pd	UTSW	4	149996062	missense	probably benign
R7704:H6pd	UTSW	4	149982903	missense	probably benign	0.45
R7954:H6pd	UTSW	4	149982826	missense	probably benign
R8226:H6pd	UTSW	4	149995989	missense	probably benign	0.02
R8420:H6pd	UTSW	4	149981676	missense	probably benign	0.01
R8757:H6pd	UTSW	4	149982301	missense	probably benign	0.05
R8759:H6pd	UTSW	4	149982301	missense	probably benign	0.05
R9275:H6pd	UTSW	4	149995850	missense	probably damaging	1.00
R9278:H6pd	UTSW	4	149995850	missense	probably damaging	1.00
R9400:H6pd	UTSW	4	149995791	missense	probably damaging	1.00
R9491:H6pd	UTSW	4	149995909	missense	probably benign	0.18
R9520:H6pd	UTSW	4	149995918	missense	possibly damaging	0.79
X0020:H6pd	UTSW	4	149982798	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGTGGAAGCTGAAACTGTGG -3'
(R):5'- AGCTCCCGACATACTTTTGGC -3'

Sequencing Primer
(F):5'- AAGCTGAAACTGTGGCCCTTC -3'
(R):5'- CCGACATACTTTTGGCACGGAAG -3'

Posted On

2018-08-01