Incidental Mutation 'R6725:Sergef'
ID529821
Institutional Source Beutler Lab
Gene Symbol Sergef
Ensembl Gene ENSMUSG00000030839
Gene Namesecretion regulating guanine nucleotide exchange factor
SynonymsGnefr, Gef, DelGEF
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R6725 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location46443154-46639807 bp(-) (GRCm38)
Type of Mutationsplice site (15 bp from exon)
DNA Base Change (assembly) G to A at 46632667 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033127] [ENSMUST00000135035] [ENSMUST00000216505]
Predicted Effect probably benign
Transcript: ENSMUST00000033127
AA Change: A147V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033127
Gene: ENSMUSG00000030839
AA Change: A147V

DomainStartEndE-ValueType
Pfam:RCC1 16 64 7.3e-13 PFAM
Pfam:RCC1_2 51 80 8e-8 PFAM
Pfam:RCC1 67 116 3.9e-11 PFAM
Pfam:RCC1_2 103 132 6.4e-11 PFAM
Pfam:RCC1 119 168 3.3e-10 PFAM
Pfam:RCC1_2 213 243 2.3e-10 PFAM
Pfam:RCC1 230 279 7.5e-8 PFAM
Pfam:RCC1 283 348 5.8e-12 PFAM
Pfam:RCC1 351 401 7.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125825
Predicted Effect probably null
Transcript: ENSMUST00000135035
SMART Domains Protein: ENSMUSP00000116461
Gene: ENSMUSG00000030839

DomainStartEndE-ValueType
Pfam:RCC1 78 121 1.5e-9 PFAM
Pfam:RCC1_2 108 137 1.8e-8 PFAM
Pfam:RCC1 124 173 2.2e-11 PFAM
Pfam:RCC1_2 160 189 4.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137988
Predicted Effect probably benign
Transcript: ENSMUST00000216505
AA Change: A147V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0762 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,743,201 Y623C probably damaging Het
Adgrv1 T C 13: 81,437,557 E4596G probably damaging Het
Adgrv1 A T 13: 81,493,210 C3267S probably damaging Het
Ankrd40 T G 11: 94,334,815 V224G probably benign Het
Ap3s2 C T 7: 79,920,642 probably benign Het
Apip T A 2: 103,092,525 D229E possibly damaging Het
Atp2b4 C T 1: 133,706,987 R1168H probably benign Het
Bcan T C 3: 87,995,484 K329R possibly damaging Het
Camk1g T C 1: 193,350,320 D261G possibly damaging Het
Ccdc30 T A 4: 119,331,599 Q490L probably damaging Het
Ccdc83 A G 7: 90,247,053 W103R probably damaging Het
Ctsl T A 13: 64,366,623 R69* probably null Het
Dchs1 C T 7: 105,758,793 R1944H probably damaging Het
Fgb T C 3: 83,043,791 Y305C probably damaging Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Gal3st2 T A 1: 93,873,702 S27T probably benign Het
Galnt13 A G 2: 54,855,232 D228G probably damaging Het
Gk5 A T 9: 96,155,470 T346S probably benign Het
Gnrhr T C 5: 86,185,313 I233V probably damaging Het
Greb1 T C 12: 16,688,567 Y1465C probably damaging Het
H6pd A G 4: 149,996,358 L10P probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ighv7-4 A T 12: 114,222,869 D94E probably damaging Het
Lamb3 T C 1: 193,304,582 Y59H probably benign Het
Msantd1 C T 5: 34,921,421 T100I probably damaging Het
Msx3 T A 7: 140,048,746 probably benign Het
Mttp C A 3: 138,107,238 A559S probably damaging Het
Myh1 C G 11: 67,201,893 D4E probably damaging Het
Olfr1018 A G 2: 85,823,790 K273R probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1295 C T 2: 111,564,907 C179Y probably damaging Het
Olfr596 A T 7: 103,310,354 D211V probably damaging Het
Pcdhac1 T C 18: 37,090,328 Y65H probably damaging Het
Pcdhga8 A T 18: 37,727,262 Y457F probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pja2 A T 17: 64,289,967 M514K probably damaging Het
Plcxd2 T C 16: 45,972,125 N284D probably damaging Het
Polr3d A T 14: 70,441,137 M129K probably benign Het
Ppp1r42 T G 1: 9,999,507 E110A probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prelid2 A G 18: 41,912,449 I132T possibly damaging Het
Slc24a2 C A 4: 87,226,882 probably null Het
Stxbp3 A T 3: 108,827,600 D24E possibly damaging Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Thsd7a G A 6: 12,555,631 H85Y possibly damaging Het
Tlr2 T A 3: 83,838,296 E160V probably benign Het
Tmem171 A T 13: 98,692,170 C157* probably null Het
Trpm3 T C 19: 22,926,028 Y1051H probably damaging Het
Vmn2r28 A G 7: 5,488,409 F280L probably benign Het
Xpo7 A T 14: 70,676,813 Y748N probably damaging Het
Zan T C 5: 137,438,520 S2024G unknown Het
Zfhx2 A T 14: 55,064,082 Y2148* probably null Het
Zscan4-ps1 T C 7: 11,065,979 T328A probably benign Het
Other mutations in Sergef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Sergef APN 7 46635420 critical splice donor site probably null
IGL00864:Sergef APN 7 46515663 splice site probably null
IGL01529:Sergef APN 7 46443518 missense probably damaging 1.00
G1patch:Sergef UTSW 7 46632667 splice site probably null
IGL03014:Sergef UTSW 7 46590756 missense probably damaging 1.00
R0472:Sergef UTSW 7 46633746 splice site probably benign
R1604:Sergef UTSW 7 46443359 missense probably benign 0.00
R1892:Sergef UTSW 7 46614616 critical splice donor site probably null
R3955:Sergef UTSW 7 46618752 missense possibly damaging 0.95
R4032:Sergef UTSW 7 46443302 nonsense probably null
R4953:Sergef UTSW 7 46633835 missense probably benign 0.01
R5140:Sergef UTSW 7 46635602 intron probably benign
R5533:Sergef UTSW 7 46614776 missense possibly damaging 0.94
R5697:Sergef UTSW 7 46639259 intron probably benign
R5930:Sergef UTSW 7 46443464 missense probably benign 0.03
R6477:Sergef UTSW 7 46633826 missense probably benign 0.19
R7511:Sergef UTSW 7 46614746 missense probably damaging 1.00
R8052:Sergef UTSW 7 46614638 missense probably damaging 1.00
Z1177:Sergef UTSW 7 46639617 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGTGATCCCCTCAAACTG -3'
(R):5'- ATGTTCGGTCTGCAGGAATAAAAG -3'

Sequencing Primer
(F):5'- GTGATCCCCTCAAACTGATTTTTAAC -3'
(R):5'- CAGCCAGAAGGTTTTTGGGC -3'
Posted On2018-08-01