Incidental Mutation 'R6725:Ccdc83'
ID529823
Institutional Source Beutler Lab
Gene Symbol Ccdc83
Ensembl Gene ENSMUSG00000030617
Gene Namecoiled-coil domain containing 83
Synonyms4930549K11Rik, 4930554C01Rik, 4932423M01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6725 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location90223873-90265777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90247053 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 103 (W103R)
Ref Sequence ENSEMBL: ENSMUSP00000102839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040413] [ENSMUST00000107220] [ENSMUST00000107221]
Predicted Effect probably damaging
Transcript: ENSMUST00000040413
AA Change: W103R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047758
Gene: ENSMUSG00000030617
AA Change: W103R

DomainStartEndE-ValueType
coiled coil region 37 75 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
coiled coil region 107 182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107220
AA Change: W103R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102838
Gene: ENSMUSG00000030617
AA Change: W103R

DomainStartEndE-ValueType
coiled coil region 37 75 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
coiled coil region 107 182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107221
AA Change: W103R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102839
Gene: ENSMUSG00000030617
AA Change: W103R

DomainStartEndE-ValueType
coiled coil region 37 75 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
coiled coil region 107 182 N/A INTRINSIC
Blast:BROMO 202 232 1e-5 BLAST
low complexity region 241 249 N/A INTRINSIC
Meta Mutation Damage Score 0.4753 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,743,201 Y623C probably damaging Het
Adgrv1 T C 13: 81,437,557 E4596G probably damaging Het
Adgrv1 A T 13: 81,493,210 C3267S probably damaging Het
Ankrd40 T G 11: 94,334,815 V224G probably benign Het
Ap3s2 C T 7: 79,920,642 probably benign Het
Apip T A 2: 103,092,525 D229E possibly damaging Het
Atp2b4 C T 1: 133,706,987 R1168H probably benign Het
Bcan T C 3: 87,995,484 K329R possibly damaging Het
Camk1g T C 1: 193,350,320 D261G possibly damaging Het
Ccdc30 T A 4: 119,331,599 Q490L probably damaging Het
Ctsl T A 13: 64,366,623 R69* probably null Het
Dchs1 C T 7: 105,758,793 R1944H probably damaging Het
Fgb T C 3: 83,043,791 Y305C probably damaging Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Gal3st2 T A 1: 93,873,702 S27T probably benign Het
Galnt13 A G 2: 54,855,232 D228G probably damaging Het
Gk5 A T 9: 96,155,470 T346S probably benign Het
Gnrhr T C 5: 86,185,313 I233V probably damaging Het
Greb1 T C 12: 16,688,567 Y1465C probably damaging Het
H6pd A G 4: 149,996,358 L10P probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ighv7-4 A T 12: 114,222,869 D94E probably damaging Het
Lamb3 T C 1: 193,304,582 Y59H probably benign Het
Msantd1 C T 5: 34,921,421 T100I probably damaging Het
Msx3 T A 7: 140,048,746 probably benign Het
Mttp C A 3: 138,107,238 A559S probably damaging Het
Myh1 C G 11: 67,201,893 D4E probably damaging Het
Olfr1018 A G 2: 85,823,790 K273R probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1295 C T 2: 111,564,907 C179Y probably damaging Het
Olfr596 A T 7: 103,310,354 D211V probably damaging Het
Pcdhac1 T C 18: 37,090,328 Y65H probably damaging Het
Pcdhga8 A T 18: 37,727,262 Y457F probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pja2 A T 17: 64,289,967 M514K probably damaging Het
Plcxd2 T C 16: 45,972,125 N284D probably damaging Het
Polr3d A T 14: 70,441,137 M129K probably benign Het
Ppp1r42 T G 1: 9,999,507 E110A probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prelid2 A G 18: 41,912,449 I132T possibly damaging Het
Sergef G A 7: 46,632,667 probably null Het
Slc24a2 C A 4: 87,226,882 probably null Het
Stxbp3 A T 3: 108,827,600 D24E possibly damaging Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Thsd7a G A 6: 12,555,631 H85Y possibly damaging Het
Tlr2 T A 3: 83,838,296 E160V probably benign Het
Tmem171 A T 13: 98,692,170 C157* probably null Het
Trpm3 T C 19: 22,926,028 Y1051H probably damaging Het
Vmn2r28 A G 7: 5,488,409 F280L probably benign Het
Xpo7 A T 14: 70,676,813 Y748N probably damaging Het
Zan T C 5: 137,438,520 S2024G unknown Het
Zfhx2 A T 14: 55,064,082 Y2148* probably null Het
Zscan4-ps1 T C 7: 11,065,979 T328A probably benign Het
Other mutations in Ccdc83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ccdc83 APN 7 90244044 missense probably damaging 1.00
IGL01092:Ccdc83 APN 7 90247105 missense probably benign 0.11
IGL01394:Ccdc83 APN 7 90224001 missense probably damaging 1.00
IGL02585:Ccdc83 APN 7 90236912 missense probably damaging 1.00
IGL02631:Ccdc83 APN 7 90244069 missense possibly damaging 0.76
G1patch:Ccdc83 UTSW 7 90247053 missense probably damaging 1.00
PIT4354001:Ccdc83 UTSW 7 90223974 missense probably benign 0.21
R0189:Ccdc83 UTSW 7 90226683 missense possibly damaging 0.94
R0538:Ccdc83 UTSW 7 90228383 missense probably damaging 0.99
R1441:Ccdc83 UTSW 7 90244143 missense probably damaging 1.00
R1478:Ccdc83 UTSW 7 90259469 missense probably damaging 0.99
R1781:Ccdc83 UTSW 7 90250541 missense probably damaging 1.00
R1929:Ccdc83 UTSW 7 90224077 missense probably damaging 1.00
R1969:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R1970:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R1971:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R2008:Ccdc83 UTSW 7 90244141 missense probably damaging 1.00
R2220:Ccdc83 UTSW 7 90259514 missense probably damaging 0.96
R2271:Ccdc83 UTSW 7 90224077 missense probably damaging 1.00
R2426:Ccdc83 UTSW 7 90228431 missense probably damaging 1.00
R2985:Ccdc83 UTSW 7 90236367 intron probably benign
R3712:Ccdc83 UTSW 7 90236355 intron probably benign
R4241:Ccdc83 UTSW 7 90247138 missense probably damaging 1.00
R4260:Ccdc83 UTSW 7 90228391 missense possibly damaging 0.86
R4374:Ccdc83 UTSW 7 90226778 nonsense probably null
R5071:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5072:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5074:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5749:Ccdc83 UTSW 7 90223948 missense probably damaging 1.00
R5929:Ccdc83 UTSW 7 90236316 intron probably benign
R6283:Ccdc83 UTSW 7 90236407 nonsense probably null
R6574:Ccdc83 UTSW 7 90226677 missense possibly damaging 0.69
R7320:Ccdc83 UTSW 7 90224034 missense probably damaging 1.00
R7485:Ccdc83 UTSW 7 90223930 missense probably benign 0.17
R7511:Ccdc83 UTSW 7 90236922 missense possibly damaging 0.69
R7750:Ccdc83 UTSW 7 90223982 nonsense probably null
R7773:Ccdc83 UTSW 7 90229912 missense probably damaging 1.00
R7915:Ccdc83 UTSW 7 90244082 nonsense probably null
R8184:Ccdc83 UTSW 7 90224078 nonsense probably null
R8416:Ccdc83 UTSW 7 90236305 missense unknown
X0067:Ccdc83 UTSW 7 90247155 missense possibly damaging 0.94
Z1088:Ccdc83 UTSW 7 90244046 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTCACTTCTTTCCAGGG -3'
(R):5'- GTGAAGAGTTGAGCAGATGTGT -3'

Sequencing Primer
(F):5'- ACTTCTTTCCAGGGCCTCTG -3'
(R):5'- AGAGTTGAGCAGATGTGTCTAACTG -3'
Posted On2018-08-01