Incidental Mutation 'R6725:Olfr596'
ID529824
Institutional Source Beutler Lab
Gene Symbol Olfr596
Ensembl Gene ENSMUSG00000073953
Gene Nameolfactory receptor 596
SynonymsOlfr596-ps1, Gm15117, ENSMUSG00000073953, GA_x6K02T2PBJ9-6019769-6019943
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6725 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103305648-103312782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103310354 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 211 (D211V)
Ref Sequence ENSEMBL: ENSMUSP00000149187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104880] [ENSMUST00000214577]
Predicted Effect probably damaging
Transcript: ENSMUST00000104880
AA Change: D211V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100475
Gene: ENSMUSG00000073953
AA Change: D211V

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.5e-121 PFAM
Pfam:7TM_GPCR_Srsx 37 210 5.1e-11 PFAM
Pfam:7tm_1 43 293 1.6e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214577
AA Change: D211V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7578 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,743,201 Y623C probably damaging Het
Adgrv1 T C 13: 81,437,557 E4596G probably damaging Het
Adgrv1 A T 13: 81,493,210 C3267S probably damaging Het
Ankrd40 T G 11: 94,334,815 V224G probably benign Het
Ap3s2 C T 7: 79,920,642 probably benign Het
Apip T A 2: 103,092,525 D229E possibly damaging Het
Atp2b4 C T 1: 133,706,987 R1168H probably benign Het
Bcan T C 3: 87,995,484 K329R possibly damaging Het
Camk1g T C 1: 193,350,320 D261G possibly damaging Het
Ccdc30 T A 4: 119,331,599 Q490L probably damaging Het
Ccdc83 A G 7: 90,247,053 W103R probably damaging Het
Ctsl T A 13: 64,366,623 R69* probably null Het
Dchs1 C T 7: 105,758,793 R1944H probably damaging Het
Fgb T C 3: 83,043,791 Y305C probably damaging Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Gal3st2 T A 1: 93,873,702 S27T probably benign Het
Galnt13 A G 2: 54,855,232 D228G probably damaging Het
Gk5 A T 9: 96,155,470 T346S probably benign Het
Gnrhr T C 5: 86,185,313 I233V probably damaging Het
Greb1 T C 12: 16,688,567 Y1465C probably damaging Het
H6pd A G 4: 149,996,358 L10P probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ighv7-4 A T 12: 114,222,869 D94E probably damaging Het
Lamb3 T C 1: 193,304,582 Y59H probably benign Het
Msantd1 C T 5: 34,921,421 T100I probably damaging Het
Msx3 T A 7: 140,048,746 probably benign Het
Mttp C A 3: 138,107,238 A559S probably damaging Het
Myh1 C G 11: 67,201,893 D4E probably damaging Het
Olfr1018 A G 2: 85,823,790 K273R probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1295 C T 2: 111,564,907 C179Y probably damaging Het
Pcdhac1 T C 18: 37,090,328 Y65H probably damaging Het
Pcdhga8 A T 18: 37,727,262 Y457F probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pja2 A T 17: 64,289,967 M514K probably damaging Het
Plcxd2 T C 16: 45,972,125 N284D probably damaging Het
Polr3d A T 14: 70,441,137 M129K probably benign Het
Ppp1r42 T G 1: 9,999,507 E110A probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prelid2 A G 18: 41,912,449 I132T possibly damaging Het
Sergef G A 7: 46,632,667 probably null Het
Slc24a2 C A 4: 87,226,882 probably null Het
Stxbp3 A T 3: 108,827,600 D24E possibly damaging Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Thsd7a G A 6: 12,555,631 H85Y possibly damaging Het
Tlr2 T A 3: 83,838,296 E160V probably benign Het
Tmem171 A T 13: 98,692,170 C157* probably null Het
Trpm3 T C 19: 22,926,028 Y1051H probably damaging Het
Vmn2r28 A G 7: 5,488,409 F280L probably benign Het
Xpo7 A T 14: 70,676,813 Y748N probably damaging Het
Zan T C 5: 137,438,520 S2024G unknown Het
Zfhx2 A T 14: 55,064,082 Y2148* probably null Het
Zscan4-ps1 T C 7: 11,065,979 T328A probably benign Het
Other mutations in Olfr596
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Olfr596 APN 7 103309807 missense probably benign 0.03
IGL01917:Olfr596 APN 7 103310357 nonsense probably null
R0601:Olfr596 UTSW 7 103310164 missense probably damaging 1.00
R0908:Olfr596 UTSW 7 103310573 missense possibly damaging 0.56
R1762:Olfr596 UTSW 7 103310221 missense probably damaging 1.00
R1772:Olfr596 UTSW 7 103310242 missense possibly damaging 0.94
R1806:Olfr596 UTSW 7 103310225 missense probably damaging 1.00
R2035:Olfr596 UTSW 7 103310256 missense probably damaging 1.00
R2365:Olfr596 UTSW 7 103310173 missense probably benign 0.00
R3827:Olfr596 UTSW 7 103309802 missense probably benign 0.12
R4241:Olfr596 UTSW 7 103310661 makesense probably null
R4619:Olfr596 UTSW 7 103309958 missense probably benign 0.04
R4620:Olfr596 UTSW 7 103309958 missense probably benign 0.04
R6279:Olfr596 UTSW 7 103310429 missense probably benign
R6300:Olfr596 UTSW 7 103310429 missense probably benign
R6505:Olfr596 UTSW 7 103309793 missense probably benign 0.00
R7175:Olfr596 UTSW 7 103309847 missense probably benign 0.22
R7708:Olfr596 UTSW 7 103310561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGCATCGGTTGTAATAGGG -3'
(R):5'- CCACATAGAGATTGGCCAAGAG -3'

Sequencing Primer
(F):5'- GGAGACCTGTCCTTCTTGTC -3'
(R):5'- TTGGCCAAGAGGATGTGAATATAAC -3'
Posted On2018-08-01