Incidental Mutation 'R6725:Polr3d'
ID529838
Institutional Source Beutler Lab
Gene Symbol Polr3d
Ensembl Gene ENSMUSG00000000776
Gene Namepolymerase (RNA) III (DNA directed) polypeptide D
SynonymsTSBN51, RPC4, 44kDa, 2810426M17Rik, BN51T
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R6725 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70438757-70443447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70441137 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 129 (M129K)
Ref Sequence ENSEMBL: ENSMUSP00000137614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000793] [ENSMUST00000180358]
Predicted Effect probably benign
Transcript: ENSMUST00000000793
AA Change: M129K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000000793
Gene: ENSMUSG00000000776
AA Change: M129K

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 217 241 N/A INTRINSIC
Pfam:RNA_pol_Rpc4 263 389 7.9e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083594
Predicted Effect probably benign
Transcript: ENSMUST00000180358
AA Change: M129K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000137614
Gene: ENSMUSG00000000776
AA Change: M129K

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 217 241 N/A INTRINSIC
Pfam:RNA_pol_Rpc4 262 389 3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227985
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene complements a temperature-sensitive mutant isolated from the BHK-21 Syrian hamster cell line. It leads to a block in progression through the G1 phase of the cell cycle at nonpermissive temperatures. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,743,201 Y623C probably damaging Het
Adgrv1 T C 13: 81,437,557 E4596G probably damaging Het
Adgrv1 A T 13: 81,493,210 C3267S probably damaging Het
Ankrd40 T G 11: 94,334,815 V224G probably benign Het
Ap3s2 C T 7: 79,920,642 probably benign Het
Apip T A 2: 103,092,525 D229E possibly damaging Het
Atp2b4 C T 1: 133,706,987 R1168H probably benign Het
Bcan T C 3: 87,995,484 K329R possibly damaging Het
Camk1g T C 1: 193,350,320 D261G possibly damaging Het
Ccdc30 T A 4: 119,331,599 Q490L probably damaging Het
Ccdc83 A G 7: 90,247,053 W103R probably damaging Het
Ctsl T A 13: 64,366,623 R69* probably null Het
Dchs1 C T 7: 105,758,793 R1944H probably damaging Het
Fgb T C 3: 83,043,791 Y305C probably damaging Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Gal3st2 T A 1: 93,873,702 S27T probably benign Het
Galnt13 A G 2: 54,855,232 D228G probably damaging Het
Gk5 A T 9: 96,155,470 T346S probably benign Het
Gnrhr T C 5: 86,185,313 I233V probably damaging Het
Greb1 T C 12: 16,688,567 Y1465C probably damaging Het
H6pd A G 4: 149,996,358 L10P probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ighv7-4 A T 12: 114,222,869 D94E probably damaging Het
Lamb3 T C 1: 193,304,582 Y59H probably benign Het
Msantd1 C T 5: 34,921,421 T100I probably damaging Het
Msx3 T A 7: 140,048,746 probably benign Het
Mttp C A 3: 138,107,238 A559S probably damaging Het
Myh1 C G 11: 67,201,893 D4E probably damaging Het
Olfr1018 A G 2: 85,823,790 K273R probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1295 C T 2: 111,564,907 C179Y probably damaging Het
Olfr596 A T 7: 103,310,354 D211V probably damaging Het
Pcdhac1 T C 18: 37,090,328 Y65H probably damaging Het
Pcdhga8 A T 18: 37,727,262 Y457F probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pja2 A T 17: 64,289,967 M514K probably damaging Het
Plcxd2 T C 16: 45,972,125 N284D probably damaging Het
Ppp1r42 T G 1: 9,999,507 E110A probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prelid2 A G 18: 41,912,449 I132T possibly damaging Het
Sergef G A 7: 46,632,667 probably null Het
Slc24a2 C A 4: 87,226,882 probably null Het
Stxbp3 A T 3: 108,827,600 D24E possibly damaging Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Thsd7a G A 6: 12,555,631 H85Y possibly damaging Het
Tlr2 T A 3: 83,838,296 E160V probably benign Het
Tmem171 A T 13: 98,692,170 C157* probably null Het
Trpm3 T C 19: 22,926,028 Y1051H probably damaging Het
Vmn2r28 A G 7: 5,488,409 F280L probably benign Het
Xpo7 A T 14: 70,676,813 Y748N probably damaging Het
Zan T C 5: 137,438,520 S2024G unknown Het
Zfhx2 A T 14: 55,064,082 Y2148* probably null Het
Zscan4-ps1 T C 7: 11,065,979 T328A probably benign Het
Other mutations in Polr3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02653:Polr3d APN 14 70440117 missense probably damaging 1.00
IGL03006:Polr3d APN 14 70441163 critical splice acceptor site probably null
G1patch:Polr3d UTSW 14 70441137 missense probably benign 0.00
PIT4449001:Polr3d UTSW 14 70439463 missense probably benign 0.27
R0568:Polr3d UTSW 14 70439519 missense possibly damaging 0.81
R1435:Polr3d UTSW 14 70440039 missense probably benign 0.22
R1710:Polr3d UTSW 14 70443010 missense probably benign 0.03
R1714:Polr3d UTSW 14 70441315 missense possibly damaging 0.90
R1748:Polr3d UTSW 14 70439475 nonsense probably null
R2136:Polr3d UTSW 14 70443047 frame shift probably null
R5506:Polr3d UTSW 14 70440759 missense possibly damaging 0.69
R5984:Polr3d UTSW 14 70439487 missense possibly damaging 0.90
R6880:Polr3d UTSW 14 70440015 missense probably benign 0.00
R7447:Polr3d UTSW 14 70439800 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGAACATGTCCCTGGCCTG -3'
(R):5'- GTCCCATTCTATCTTCGAGCAGG -3'

Sequencing Primer
(F):5'- TGGCCTGGCTCCCTCAAAAC -3'
(R):5'- ATTCTATCTTCGAGCAGGGTCCG -3'
Posted On2018-08-01