Mutagenetix > Incidental Mutation

Incidental Mutation 'R6726:Sgo2b'

529868

Institutional Source

Beutler Lab

Gene Symbol

Sgo2b

Ensembl Gene

ENSMUSG00000094443

Gene Name

shugoshin 2B

Synonyms

Gm4975, Sgol2b

MMRRC Submission

044844-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R6726 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64377728-64405204 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 64380769 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 688 (K688*)

Ref Sequence

ENSEMBL: ENSMUSP00000136323 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000179944]

AlphaFold

J3QMK1

Predicted Effect

probably null
Transcript: ENSMUST00000179944
AA Change: K688*

SMART Domains

Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: K688*

Domain	Start	End	E-Value	Type
coiled coil region	54	113	N/A	INTRINSIC
low complexity region	122	135	N/A	INTRINSIC
low complexity region	163	172	N/A	INTRINSIC
low complexity region	400	414	N/A	INTRINSIC
internal_repeat_1	528	618	9.12e-8	PROSPERO
internal_repeat_1	713	809	9.12e-8	PROSPERO
low complexity region	1009	1024	N/A	INTRINSIC
low complexity region	1059	1081	N/A	INTRINSIC
low complexity region	1112	1126	N/A	INTRINSIC
low complexity region	1130	1148	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210915

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

100% (41/41)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot11	C	T	4: 106,617,327 (GRCm39)	G240R	probably damaging	Het
Arfgef2	T	A	2: 166,735,540 (GRCm39)		probably null	Het
Arsk	T	C	13: 76,222,907 (GRCm39)	Y230C	probably damaging	Het
Atf7ip	G	A	6: 136,559,389 (GRCm39)	V737M	probably damaging	Het
Atp6v1e1	A	T	6: 120,781,011 (GRCm39)		probably null	Het
Bbs9	T	C	9: 22,557,260 (GRCm39)	V3A	probably benign	Het
Brap	T	C	5: 121,813,365 (GRCm39)	S243P	probably damaging	Het
Camkmt	T	A	17: 85,702,037 (GRCm39)	I167N	probably damaging	Het
Ckap2l	C	A	2: 129,111,114 (GRCm39)	E694D	probably damaging	Het
Crmp1	G	A	5: 37,441,408 (GRCm39)	V497I	probably benign	Het
Dbx2	A	G	15: 95,522,741 (GRCm39)	V322A	possibly damaging	Het
Dll1	C	A	17: 15,590,513 (GRCm39)	C401F	probably damaging	Het
Dock10	T	C	1: 80,490,147 (GRCm39)	T1991A	probably damaging	Het
Dock3	C	T	9: 107,036,651 (GRCm39)	W42*	probably null	Het
Epha6	C	A	16: 60,245,198 (GRCm39)	A334S	possibly damaging	Het
Hdac1-ps	A	G	17: 78,800,287 (GRCm39)	E426G	probably damaging	Het
Insrr	C	T	3: 87,720,873 (GRCm39)	R1044C	probably damaging	Het
Irs2	T	C	8: 11,054,961 (GRCm39)	N1157S	possibly damaging	Het
Kndc1	T	C	7: 139,502,667 (GRCm39)		probably null	Het
Map3k19	T	C	1: 127,748,185 (GRCm39)	N1241S	probably benign	Het
Or9g4b	T	C	2: 85,615,906 (GRCm39)	F17S	possibly damaging	Het
Paqr5	C	T	9: 61,871,065 (GRCm39)	R171Q	probably damaging	Het
Pcdh17	T	A	14: 84,683,657 (GRCm39)	D41E	probably damaging	Het
Plg	T	G	17: 12,597,595 (GRCm39)	L14R	probably damaging	Het
Prkab1	A	G	5: 116,158,092 (GRCm39)	V168A	probably benign	Het
Prr35	G	C	17: 26,166,689 (GRCm39)	P283A	probably benign	Het
Ptdss1	C	T	13: 67,101,595 (GRCm39)	R95*	probably null	Het
Rab3gap2	T	G	1: 184,980,062 (GRCm39)	S327A	probably damaging	Het
Rnd2	C	T	11: 101,359,825 (GRCm39)	L57F	probably damaging	Het
Rsf1	G	A	7: 97,229,117 (GRCm39)		probably benign	Homo
Sdr42e2	T	C	7: 120,425,332 (GRCm39)	S308P	probably damaging	Het
Senp8	C	A	9: 59,644,473 (GRCm39)	V228L	probably benign	Het
Serpina10	A	T	12: 103,594,628 (GRCm39)	I197K	probably benign	Het
Serpinb6d	A	G	13: 33,854,718 (GRCm39)	N231S	probably benign	Het
Sez6l2	T	C	7: 126,567,177 (GRCm39)	V869A	probably damaging	Het
Sh3kbp1	A	T	X: 158,624,176 (GRCm39)	E39D	probably benign	Homo
Ufsp2	T	C	8: 46,438,504 (GRCm39)	M194T	probably benign	Het
Ush2a	T	C	1: 188,485,881 (GRCm39)	I2997T	possibly damaging	Het
Vmn2r107	G	A	17: 20,595,637 (GRCm39)	G730D	probably damaging	Het
Wdr72	T	C	9: 74,059,822 (GRCm39)	Y411H	possibly damaging	Het
Xirp2	T	C	2: 67,343,212 (GRCm39)	S1818P	possibly damaging	Het

Other mutations in Sgo2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Sgo2b	APN	8	64,379,557 (GRCm39)	missense	probably benign
IGL01343:Sgo2b	APN	8	64,380,349 (GRCm39)	nonsense	probably null
IGL02027:Sgo2b	APN	8	64,379,863 (GRCm39)	missense	probably benign
IGL02090:Sgo2b	APN	8	64,380,123 (GRCm39)	missense	probably damaging	0.99
IGL02121:Sgo2b	APN	8	64,384,316 (GRCm39)	missense	possibly damaging	0.94
IGL02206:Sgo2b	APN	8	64,394,118 (GRCm39)	missense	possibly damaging	0.94
IGL02554:Sgo2b	APN	8	64,379,571 (GRCm39)	missense	probably damaging	0.96
IGL02663:Sgo2b	APN	8	64,396,148 (GRCm39)	missense	probably damaging	0.97
IGL03149:Sgo2b	APN	8	64,379,617 (GRCm39)	missense	probably benign	0.14
floater	UTSW	8	64,391,451 (GRCm39)	nonsense	probably null
R0164:Sgo2b	UTSW	8	64,391,417 (GRCm39)	missense	possibly damaging	0.92
R0164:Sgo2b	UTSW	8	64,391,417 (GRCm39)	missense	possibly damaging	0.92
R0201:Sgo2b	UTSW	8	64,379,670 (GRCm39)	missense	probably benign
R0285:Sgo2b	UTSW	8	64,381,823 (GRCm39)	nonsense	probably null
R0325:Sgo2b	UTSW	8	64,381,410 (GRCm39)	missense	probably benign	0.20
R0727:Sgo2b	UTSW	8	64,380,816 (GRCm39)	missense	probably damaging	0.98
R0943:Sgo2b	UTSW	8	64,384,369 (GRCm39)	missense	possibly damaging	0.82
R1148:Sgo2b	UTSW	8	64,379,889 (GRCm39)	missense	probably damaging	0.99
R1266:Sgo2b	UTSW	8	64,381,455 (GRCm39)	missense	probably benign	0.00
R1484:Sgo2b	UTSW	8	64,384,507 (GRCm39)	missense	possibly damaging	0.77
R1493:Sgo2b	UTSW	8	64,379,889 (GRCm39)	missense	probably damaging	0.99
R1537:Sgo2b	UTSW	8	64,379,536 (GRCm39)	missense	possibly damaging	0.94
R1630:Sgo2b	UTSW	8	64,380,831 (GRCm39)	missense	possibly damaging	0.90
R1803:Sgo2b	UTSW	8	64,380,426 (GRCm39)	missense	probably benign	0.01
R1912:Sgo2b	UTSW	8	64,384,503 (GRCm39)	missense	probably damaging	0.98
R1993:Sgo2b	UTSW	8	64,379,867 (GRCm39)	missense	probably benign	0.36
R2042:Sgo2b	UTSW	8	64,381,561 (GRCm39)	missense	probably benign
R2130:Sgo2b	UTSW	8	64,380,181 (GRCm39)	missense	probably benign	0.09
R2146:Sgo2b	UTSW	8	64,381,057 (GRCm39)	missense	probably benign	0.00
R2881:Sgo2b	UTSW	8	64,380,570 (GRCm39)	missense	probably damaging	0.99
R3686:Sgo2b	UTSW	8	64,384,361 (GRCm39)	missense	probably benign	0.20
R3706:Sgo2b	UTSW	8	64,381,179 (GRCm39)	missense	probably damaging	0.98
R3889:Sgo2b	UTSW	8	64,380,777 (GRCm39)	missense	possibly damaging	0.82
R3894:Sgo2b	UTSW	8	64,381,767 (GRCm39)	missense	possibly damaging	0.91
R3895:Sgo2b	UTSW	8	64,381,767 (GRCm39)	missense	possibly damaging	0.91
R4058:Sgo2b	UTSW	8	64,379,981 (GRCm39)	missense	probably damaging	0.98
R4259:Sgo2b	UTSW	8	64,381,330 (GRCm39)	missense	probably benign	0.06
R4260:Sgo2b	UTSW	8	64,381,330 (GRCm39)	missense	probably benign	0.06
R4704:Sgo2b	UTSW	8	64,380,824 (GRCm39)	missense	probably damaging	0.98
R4815:Sgo2b	UTSW	8	64,384,448 (GRCm39)	missense	probably benign
R4922:Sgo2b	UTSW	8	64,379,664 (GRCm39)	missense	possibly damaging	0.66
R5232:Sgo2b	UTSW	8	64,381,636 (GRCm39)	missense	possibly damaging	0.55
R5262:Sgo2b	UTSW	8	64,396,171 (GRCm39)	missense	probably damaging	0.99
R5444:Sgo2b	UTSW	8	64,379,590 (GRCm39)	missense	possibly damaging	0.90
R5677:Sgo2b	UTSW	8	64,380,008 (GRCm39)	missense	possibly damaging	0.77
R5959:Sgo2b	UTSW	8	64,380,322 (GRCm39)	missense	probably benign	0.01
R6004:Sgo2b	UTSW	8	64,379,707 (GRCm39)	nonsense	probably null
R6267:Sgo2b	UTSW	8	64,380,827 (GRCm39)	missense	probably benign
R6296:Sgo2b	UTSW	8	64,380,827 (GRCm39)	missense	probably benign
R6328:Sgo2b	UTSW	8	64,381,345 (GRCm39)	nonsense	probably null
R6517:Sgo2b	UTSW	8	64,384,528 (GRCm39)	missense	probably damaging	0.99
R6523:Sgo2b	UTSW	8	64,380,538 (GRCm39)	missense	probably benign	0.11
R6957:Sgo2b	UTSW	8	64,384,489 (GRCm39)	small deletion	probably benign
R7031:Sgo2b	UTSW	8	64,393,078 (GRCm39)	missense	possibly damaging	0.94
R7034:Sgo2b	UTSW	8	64,379,868 (GRCm39)	missense	probably benign	0.36
R7145:Sgo2b	UTSW	8	64,381,218 (GRCm39)	missense	probably damaging	1.00
R7289:Sgo2b	UTSW	8	64,394,192 (GRCm39)	missense	probably damaging	0.97
R7366:Sgo2b	UTSW	8	64,391,451 (GRCm39)	nonsense	probably null
R7660:Sgo2b	UTSW	8	64,393,108 (GRCm39)	missense	probably benign	0.27
R7761:Sgo2b	UTSW	8	64,379,946 (GRCm39)	missense	probably benign
R7762:Sgo2b	UTSW	8	64,379,531 (GRCm39)	missense	probably benign	0.03
R7822:Sgo2b	UTSW	8	64,380,318 (GRCm39)	missense	probably damaging	0.98
R8111:Sgo2b	UTSW	8	64,396,138 (GRCm39)	missense	probably damaging	0.98
R8129:Sgo2b	UTSW	8	64,381,834 (GRCm39)	missense	possibly damaging	0.90
R8273:Sgo2b	UTSW	8	64,377,735 (GRCm39)	missense	unknown
R8856:Sgo2b	UTSW	8	64,393,091 (GRCm39)	missense	probably null	0.99
R9249:Sgo2b	UTSW	8	64,391,407 (GRCm39)	nonsense	probably null
R9428:Sgo2b	UTSW	8	64,393,067 (GRCm39)	missense	probably damaging	0.99
R9616:Sgo2b	UTSW	8	64,380,274 (GRCm39)	missense	probably benign
R9621:Sgo2b	UTSW	8	64,380,651 (GRCm39)	missense	probably damaging	0.99
RF014:Sgo2b	UTSW	8	64,384,439 (GRCm39)	missense	possibly damaging	0.94
RF055:Sgo2b	UTSW	8	64,396,203 (GRCm39)	missense	probably damaging	1.00
Z1088:Sgo2b	UTSW	8	64,381,456 (GRCm39)	missense	possibly damaging	0.61
Z1088:Sgo2b	UTSW	8	64,380,039 (GRCm39)	missense	probably damaging	1.00
Z1177:Sgo2b	UTSW	8	64,381,419 (GRCm39)	missense	possibly damaging	0.82
Z1177:Sgo2b	UTSW	8	64,380,473 (GRCm39)	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TTTTCAACCCCAAGAGCATTTCAG -3'
(R):5'- GGCAACTTTCCCTTCCAAAC -3'

Sequencing Primer
(F):5'- CACTATCTTGGTTACAAAGAGCAGGC -3'
(R):5'- TTTCCCTTCCAAACCCAAGCAG -3'

Posted On

2018-08-01