Incidental Mutation 'R6726:Pcdh17'
ID529879
Institutional Source Beutler Lab
Gene Symbol Pcdh17
Ensembl Gene ENSMUSG00000035566
Gene Nameprotocadherin 17
SynonymsC030033F14Rik, LOC219228
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location84443563-84539002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84446217 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 41 (D41E)
Ref Sequence ENSEMBL: ENSMUSP00000071325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071370]
Predicted Effect probably damaging
Transcript: ENSMUST00000071370
AA Change: D41E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071325
Gene: ENSMUSG00000035566
AA Change: D41E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 54 131 6.8e-4 SMART
CA 155 242 8.81e-21 SMART
CA 266 350 8.27e-26 SMART
CA 375 468 9.14e-28 SMART
CA 492 579 8.4e-27 SMART
CA 608 687 2.53e-12 SMART
low complexity region 703 725 N/A INTRINSIC
low complexity region 751 759 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226362
Meta Mutation Damage Score 0.4842 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic transmission, increased synaptic vesicle number and decreased depression-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Serpinb6d A G 13: 33,670,735 N231S probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Pcdh17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pcdh17 APN 14 84447544 missense probably damaging 1.00
IGL00902:Pcdh17 APN 14 84446849 missense probably damaging 1.00
IGL01596:Pcdh17 APN 14 84448192 missense probably damaging 1.00
IGL01665:Pcdh17 APN 14 84447002 missense probably damaging 0.99
IGL01944:Pcdh17 APN 14 84447520 missense probably benign 0.01
IGL01944:Pcdh17 APN 14 84447521 missense probably damaging 0.98
IGL01977:Pcdh17 APN 14 84533097 missense possibly damaging 0.49
IGL01988:Pcdh17 APN 14 84446622 missense probably damaging 1.00
IGL02168:Pcdh17 APN 14 84533195 missense probably benign 0.19
IGL02500:Pcdh17 APN 14 84533469 missense probably benign 0.17
IGL02874:Pcdh17 APN 14 84448240 missense possibly damaging 0.71
IGL02882:Pcdh17 APN 14 84446661 missense probably damaging 0.98
IGL02941:Pcdh17 APN 14 84448307 missense probably damaging 1.00
IGL03328:Pcdh17 APN 14 84533111 missense probably benign
PIT4151001:Pcdh17 UTSW 14 84447358 missense probably benign 0.05
R0226:Pcdh17 UTSW 14 84448201 missense probably damaging 0.99
R0537:Pcdh17 UTSW 14 84447457 missense probably damaging 1.00
R0647:Pcdh17 UTSW 14 84447773 missense possibly damaging 0.58
R0939:Pcdh17 UTSW 14 84447755 missense probably damaging 1.00
R1014:Pcdh17 UTSW 14 84447488 missense probably damaging 1.00
R1753:Pcdh17 UTSW 14 84477654 missense probably benign 0.17
R3404:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3405:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3406:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3746:Pcdh17 UTSW 14 84533037 missense probably benign 0.02
R3852:Pcdh17 UTSW 14 84447259 nonsense probably null
R4015:Pcdh17 UTSW 14 84447107 missense probably damaging 0.99
R4348:Pcdh17 UTSW 14 84447620 missense probably damaging 0.97
R4365:Pcdh17 UTSW 14 84448286 missense probably damaging 0.97
R4375:Pcdh17 UTSW 14 84448271 missense possibly damaging 0.80
R4693:Pcdh17 UTSW 14 84533520 missense probably damaging 1.00
R4811:Pcdh17 UTSW 14 84447935 missense probably damaging 1.00
R5007:Pcdh17 UTSW 14 84533297 missense probably benign
R5074:Pcdh17 UTSW 14 84533342 missense probably benign
R5080:Pcdh17 UTSW 14 84533310 missense probably benign 0.01
R5138:Pcdh17 UTSW 14 84447209 missense probably damaging 1.00
R5330:Pcdh17 UTSW 14 84533046 missense probably damaging 1.00
R5541:Pcdh17 UTSW 14 84447416 missense probably damaging 0.97
R5686:Pcdh17 UTSW 14 84532993 missense probably damaging 1.00
R5692:Pcdh17 UTSW 14 84448540 missense probably benign 0.22
R5695:Pcdh17 UTSW 14 84446360 missense probably damaging 1.00
R5949:Pcdh17 UTSW 14 84447556 missense probably damaging 1.00
R6127:Pcdh17 UTSW 14 84533060 missense probably damaging 0.96
R6294:Pcdh17 UTSW 14 84477668 missense probably benign 0.01
R6508:Pcdh17 UTSW 14 84447979 missense probably damaging 1.00
R7094:Pcdh17 UTSW 14 84447395 missense probably damaging 1.00
R7137:Pcdh17 UTSW 14 84533549 missense possibly damaging 0.65
X0025:Pcdh17 UTSW 14 84446562 missense possibly damaging 0.86
X0026:Pcdh17 UTSW 14 84533097 missense possibly damaging 0.49
X0027:Pcdh17 UTSW 14 84448310 missense possibly damaging 0.80
Z1088:Pcdh17 UTSW 14 84448274 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AAGACTCGCAGACTTGTGG -3'
(R):5'- GCATAAGGACTCACGGTCGATG -3'

Sequencing Primer
(F):5'- AGACTTGTGGCTCGCTCC -3'
(R):5'- ACTCACGGTCGATGCGCTG -3'
Posted On2018-08-01