Incidental Mutation 'R6727:Atg16l1'
ID529889
Institutional Source Beutler Lab
Gene Symbol Atg16l1
Ensembl Gene ENSMUSG00000026289
Gene Nameautophagy related 16-like 1 (S. cerevisiae)
Synonyms1500009K01Rik, APG16L, WDR30
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87755870-87792428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87774854 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 279 (I279T)
Ref Sequence ENSEMBL: ENSMUSP00000108815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027512] [ENSMUST00000113186] [ENSMUST00000113190] [ENSMUST00000144047]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027512
AA Change: I279T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289
AA Change: I279T

DomainStartEndE-ValueType
Pfam:ATG16 13 207 1.3e-63 PFAM
low complexity region 237 246 N/A INTRINSIC
WD40 311 350 7.05e-9 SMART
WD40 355 394 7.28e-2 SMART
WD40 397 436 1.07e-8 SMART
WD40 439 475 3.7e0 SMART
WD40 478 516 5.35e-1 SMART
WD40 519 562 1.2e-2 SMART
WD40 565 605 6.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113186
SMART Domains Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289

DomainStartEndE-ValueType
Pfam:ATG16 13 207 3.7e-64 PFAM
low complexity region 237 246 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
WD40 292 331 7.05e-9 SMART
WD40 336 375 7.28e-2 SMART
WD40 378 417 1.07e-8 SMART
WD40 420 456 3.7e0 SMART
WD40 459 497 5.35e-1 SMART
WD40 500 543 1.2e-2 SMART
WD40 546 586 6.89e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113190
AA Change: I279T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289
AA Change: I279T

DomainStartEndE-ValueType
Pfam:ATG16 16 206 6.5e-49 PFAM
low complexity region 237 246 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
WD40 327 366 7.05e-9 SMART
WD40 371 410 7.28e-2 SMART
WD40 413 452 1.07e-8 SMART
WD40 455 491 3.7e0 SMART
WD40 494 532 5.35e-1 SMART
WD40 535 578 1.2e-2 SMART
WD40 581 621 6.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139628
Predicted Effect probably benign
Transcript: ENSMUST00000144047
SMART Domains Protein: ENSMUSP00000120955
Gene: ENSMUSG00000026289

DomainStartEndE-ValueType
Pfam:ATG16 1 145 2.9e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157343
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Null homozygotes have a cellular defect in autophagy that results in lethality during the neonatal starvation period. Mice homozygous for hypomorphic alleles have Paneth cells with aberrant, disorganized granules similar to those found in patients with Crohn's disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Atg16l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Atg16l1 APN 1 87765397 missense possibly damaging 0.68
IGL00861:Atg16l1 APN 1 87774838 missense probably damaging 1.00
IGL01065:Atg16l1 APN 1 87785931 missense probably damaging 0.99
IGL01068:Atg16l1 APN 1 87774824 missense probably damaging 1.00
IGL01140:Atg16l1 APN 1 87774853 missense probably benign 0.03
R0023:Atg16l1 UTSW 1 87789465 missense probably benign 0.00
R0023:Atg16l1 UTSW 1 87789465 missense probably benign 0.00
R0650:Atg16l1 UTSW 1 87781699 missense possibly damaging 0.93
R0655:Atg16l1 UTSW 1 87766829 missense probably damaging 1.00
R1421:Atg16l1 UTSW 1 87786358 splice site probably benign
R1549:Atg16l1 UTSW 1 87774188 missense probably benign
R2202:Atg16l1 UTSW 1 87767015 missense probably benign 0.03
R2204:Atg16l1 UTSW 1 87767015 missense probably benign 0.03
R3689:Atg16l1 UTSW 1 87785904 missense probably damaging 1.00
R4012:Atg16l1 UTSW 1 87766907 missense probably damaging 1.00
R4391:Atg16l1 UTSW 1 87760120 missense probably damaging 0.97
R4839:Atg16l1 UTSW 1 87766174 missense probably damaging 0.99
R4935:Atg16l1 UTSW 1 87767042 missense possibly damaging 0.69
R4980:Atg16l1 UTSW 1 87766831 missense possibly damaging 0.89
R4990:Atg16l1 UTSW 1 87789369 missense probably benign 0.00
R5011:Atg16l1 UTSW 1 87774180 nonsense probably null
R5457:Atg16l1 UTSW 1 87775091 missense probably damaging 0.96
R5897:Atg16l1 UTSW 1 87785997 critical splice donor site probably null
R6289:Atg16l1 UTSW 1 87756215 missense probably damaging 0.99
R6437:Atg16l1 UTSW 1 87790648 missense probably damaging 1.00
R6923:Atg16l1 UTSW 1 87774356 intron probably null
R7423:Atg16l1 UTSW 1 87786301 missense probably damaging 1.00
R7475:Atg16l1 UTSW 1 87760083 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCCTGGTGGTTCAAATGCTG -3'
(R):5'- GGGAAAGGCCATAGATCAGCTC -3'

Sequencing Primer
(F):5'- TCAAATGCTGTGTTGAGTTTGTC -3'
(R):5'- GCCATAGATCAGCTCGCAGC -3'
Posted On2018-08-01