Incidental Mutation 'R6727:Barhl1'
ID529891
Institutional Source Beutler Lab
Gene Symbol Barhl1
Ensembl Gene ENSMUSG00000026805
Gene NameBarH like homeobox 1
SynonymsDres115, MBH2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location28907679-28916668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28915483 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 66 (P66L)
Ref Sequence ENSEMBL: ENSMUSP00000109480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050776] [ENSMUST00000113847] [ENSMUST00000113849]
Predicted Effect probably benign
Transcript: ENSMUST00000050776
AA Change: P66L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000053147
Gene: ENSMUSG00000026805
AA Change: P66L

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113847
AA Change: P66L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109478
Gene: ENSMUSG00000026805
AA Change: P66L

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113849
AA Change: P66L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109480
Gene: ENSMUSG00000026805
AA Change: P66L

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124059
SMART Domains Protein: ENSMUSP00000134363
Gene: ENSMUSG00000026805

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 76 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174027
SMART Domains Protein: ENSMUSP00000134118
Gene: ENSMUSG00000026805

DomainStartEndE-ValueType
HOX 1 32 2.5e-3 SMART
low complexity region 101 113 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in progressive hearing loss starting at 2 weeks of age. Animals are completely deaf by 10 months of age and show degeneration of the inner and outer cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Barhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Barhl1 APN 2 28915546 missense probably benign 0.03
IGL02337:Barhl1 APN 2 28911419 missense probably damaging 1.00
IGL03113:Barhl1 APN 2 28915456 missense probably benign 0.03
R0449:Barhl1 UTSW 2 28915292 missense probably benign 0.06
R1675:Barhl1 UTSW 2 28915411 missense possibly damaging 0.86
R1829:Barhl1 UTSW 2 28909845 missense probably damaging 1.00
R3615:Barhl1 UTSW 2 28911550 missense possibly damaging 0.75
R3616:Barhl1 UTSW 2 28911550 missense possibly damaging 0.75
R4937:Barhl1 UTSW 2 28909773 missense probably damaging 1.00
R5481:Barhl1 UTSW 2 28915340 missense probably damaging 0.98
R6075:Barhl1 UTSW 2 28915219 missense probably damaging 0.99
R6728:Barhl1 UTSW 2 28915483 missense probably benign 0.01
R7096:Barhl1 UTSW 2 28909714 missense probably benign
R7123:Barhl1 UTSW 2 28909931 splice site probably null
R7336:Barhl1 UTSW 2 28909843 missense probably benign 0.40
R7339:Barhl1 UTSW 2 28909887 missense probably damaging 1.00
R7584:Barhl1 UTSW 2 28909791 missense probably damaging 0.99
X0065:Barhl1 UTSW 2 28915339 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTTGTCTCGAAAGTCCTC -3'
(R):5'- GGCTTTGGGATTGACTCCATTC -3'

Sequencing Primer
(F):5'- TCTCGAAAGTCCTCCCCGG -3'
(R):5'- ATTCTCTCCCACCGAGCGG -3'
Posted On2018-08-01