Incidental Mutation 'R6727:Fgb'
ID529895
Institutional Source Beutler Lab
Gene Symbol Fgb
Ensembl Gene ENSMUSG00000033831
Gene Namefibrinogen beta chain
Synonyms2510049G14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location83040141-83049863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83046787 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 48 (S48N)
Ref Sequence ENSEMBL: ENSMUSP00000039472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048246
AA Change: S48N

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039472
Gene: ENSMUSG00000033831
AA Change: S48N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
Fib_alpha 80 225 1.28e-64 SMART
FBG 226 477 1.6e-140 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded preproprotein is proteolytically processed by thrombin to release an N-terminal fibrinopeptide during the conversion of fibrinogen to insoluble fibrin polymer. The encoded protein interacts with the amyloid beta peptide to form fibrin clots of abnormal structure, and may play an important role in Alzheimer's disease. This gene is located adjacent to the genes encoding fibrinogen alpha and gamma subunits on chromosome 3. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Fgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Fgb APN 3 83043291 missense possibly damaging 0.95
IGL02129:Fgb APN 3 83043418 missense probably benign 0.05
IGL02148:Fgb APN 3 83043287 missense probably damaging 0.99
IGL02286:Fgb APN 3 83043326 missense probably benign
IGL02601:Fgb APN 3 83045060 missense probably benign 0.06
IGL02721:Fgb APN 3 83043367 missense possibly damaging 0.89
R1217:Fgb UTSW 3 83043257 missense probably damaging 0.99
R1424:Fgb UTSW 3 83046763 missense probably damaging 0.99
R1913:Fgb UTSW 3 83044980 missense probably benign 0.03
R1990:Fgb UTSW 3 83044253 nonsense probably null
R2063:Fgb UTSW 3 83049689 missense probably benign 0.09
R2065:Fgb UTSW 3 83049689 missense probably benign 0.09
R2066:Fgb UTSW 3 83049689 missense probably benign 0.09
R2067:Fgb UTSW 3 83049689 missense probably benign 0.09
R2251:Fgb UTSW 3 83043284 missense probably damaging 1.00
R4682:Fgb UTSW 3 83043265 missense probably benign 0.00
R5045:Fgb UTSW 3 83043373 missense probably damaging 1.00
R5573:Fgb UTSW 3 83049677 splice site probably null
R5766:Fgb UTSW 3 83046176 missense probably damaging 1.00
R6103:Fgb UTSW 3 83043863 missense probably benign 0.22
R6315:Fgb UTSW 3 83045055 missense probably benign 0.00
R6469:Fgb UTSW 3 83046142 nonsense probably null
R6664:Fgb UTSW 3 83046759 missense probably damaging 1.00
R6725:Fgb UTSW 3 83043791 missense probably damaging 1.00
R6830:Fgb UTSW 3 83045025 missense probably benign 0.07
R7016:Fgb UTSW 3 83046064 missense probably benign 0.01
R7132:Fgb UTSW 3 83046746 nonsense probably null
R7371:Fgb UTSW 3 83046052 missense probably damaging 0.99
R7430:Fgb UTSW 3 83046707 missense probably benign 0.26
R7681:Fgb UTSW 3 83049832 start gained probably benign
R7811:Fgb UTSW 3 83049697 missense probably benign
R8171:Fgb UTSW 3 83042515 missense not run
Z1177:Fgb UTSW 3 83045056 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTCTGCACTGGAGACCCAC -3'
(R):5'- CTCCATCTGCTTGAAGAGACAC -3'

Sequencing Primer
(F):5'- GCACTGGAGACCCACCCTAC -3'
(R):5'- CAGTGGAGAGCCCTGTAGCATAC -3'
Posted On2018-08-01