Incidental Mutation 'R6727:Insrr'
ID529896
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Nameinsulin receptor-related receptor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location87796951-87816101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87813566 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1044 (R1044C)
Ref Sequence ENSEMBL: ENSMUSP00000103208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
Predicted Effect probably damaging
Transcript: ENSMUST00000029711
AA Change: R1044C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: R1044C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107582
AA Change: R1044C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: R1044C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87813674 critical splice donor site probably null
IGL00801:Insrr APN 3 87813808 missense probably damaging 1.00
IGL01628:Insrr APN 3 87800792 nonsense probably null
IGL01755:Insrr APN 3 87814186 missense probably damaging 1.00
IGL02100:Insrr APN 3 87811620 missense probably damaging 1.00
IGL02261:Insrr APN 3 87800722 missense probably damaging 1.00
IGL02366:Insrr APN 3 87809909 missense possibly damaging 0.91
IGL02387:Insrr APN 3 87813127 missense probably damaging 1.00
IGL02478:Insrr APN 3 87809412 missense probably benign 0.14
IGL02550:Insrr APN 3 87804498 missense probably damaging 1.00
IGL02555:Insrr APN 3 87813817 missense probably damaging 0.99
IGL02673:Insrr APN 3 87813061 missense possibly damaging 0.95
IGL02724:Insrr APN 3 87809572 missense probably benign 0.31
IGL02798:Insrr APN 3 87810517 missense probably damaging 1.00
IGL02969:Insrr APN 3 87814191 nonsense probably null
IGL03073:Insrr APN 3 87809938 splice site probably benign
IGL03178:Insrr APN 3 87802541 intron probably null
IGL03389:Insrr APN 3 87808731 missense probably damaging 1.00
IGL03399:Insrr APN 3 87809331 missense probably null 0.99
IGL02799:Insrr UTSW 3 87813581 missense probably damaging 1.00
R0011:Insrr UTSW 3 87809616 missense possibly damaging 0.86
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0357:Insrr UTSW 3 87808646 intron probably null
R0501:Insrr UTSW 3 87810684 missense probably benign 0.12
R0504:Insrr UTSW 3 87813156 missense possibly damaging 0.69
R0522:Insrr UTSW 3 87800872 missense probably damaging 1.00
R0555:Insrr UTSW 3 87814437 splice site probably benign
R0558:Insrr UTSW 3 87810981 missense possibly damaging 0.77
R0599:Insrr UTSW 3 87813133 missense probably damaging 0.97
R1312:Insrr UTSW 3 87800490 missense probably damaging 1.00
R1694:Insrr UTSW 3 87804062 missense probably benign
R1785:Insrr UTSW 3 87810572 splice site probably null
R1786:Insrr UTSW 3 87810572 splice site probably null
R1892:Insrr UTSW 3 87813877 missense probably damaging 1.00
R1950:Insrr UTSW 3 87814513 missense probably damaging 1.00
R2080:Insrr UTSW 3 87814291 missense possibly damaging 0.79
R2094:Insrr UTSW 3 87803181 missense probably damaging 1.00
R2130:Insrr UTSW 3 87810572 splice site probably null
R2131:Insrr UTSW 3 87810572 splice site probably null
R2133:Insrr UTSW 3 87810572 splice site probably null
R2220:Insrr UTSW 3 87809418 missense probably damaging 1.00
R2259:Insrr UTSW 3 87800452 missense probably damaging 1.00
R2404:Insrr UTSW 3 87802667 missense possibly damaging 0.71
R4027:Insrr UTSW 3 87809599 missense probably benign
R4042:Insrr UTSW 3 87813827 missense probably damaging 1.00
R4510:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4511:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4571:Insrr UTSW 3 87800887 missense probably benign
R4870:Insrr UTSW 3 87811604 missense probably damaging 1.00
R5057:Insrr UTSW 3 87815265 missense probably benign 0.00
R5393:Insrr UTSW 3 87810700 intron probably null
R5685:Insrr UTSW 3 87800496 intron probably null
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6047:Insrr UTSW 3 87804176 missense probably damaging 1.00
R6276:Insrr UTSW 3 87800519 nonsense probably null
R6298:Insrr UTSW 3 87812965 missense probably damaging 1.00
R6726:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6728:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6796:Insrr UTSW 3 87813566 missense probably damaging 1.00
R7041:Insrr UTSW 3 87815244 missense probably damaging 1.00
R7169:Insrr UTSW 3 87808594 missense probably benign 0.15
R7270:Insrr UTSW 3 87803133 missense probably damaging 1.00
R7340:Insrr UTSW 3 87814316 critical splice donor site probably null
R7398:Insrr UTSW 3 87808732 missense probably damaging 1.00
R7815:Insrr UTSW 3 87808695 missense probably damaging 0.98
RF022:Insrr UTSW 3 87804485 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TGAGCACGTCATGATTATGGTG -3'
(R):5'- TCATGTCACTGAGTGCAGGC -3'

Sequencing Primer
(F):5'- GCACGTCATGATTATGGTGATAATC -3'
(R):5'- GGTGAAGGACTTCCCCACAC -3'
Posted On2018-08-01