Incidental Mutation 'R6727:Dnaic1'
ID529897
Institutional Source Beutler Lab
Gene Symbol Dnaic1
Ensembl Gene ENSMUSG00000061322
Gene Namedynein, axonemal, intermediate chain 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location41569775-41638158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41625308 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 424 (R424L)
Ref Sequence ENSEMBL: ENSMUSP00000100028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102963]
Predicted Effect probably benign
Transcript: ENSMUST00000102963
AA Change: R424L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100028
Gene: ENSMUSG00000061322
AA Change: R424L

DomainStartEndE-ValueType
low complexity region 134 158 N/A INTRINSIC
low complexity region 238 261 N/A INTRINSIC
Blast:WD40 319 370 1e-17 BLAST
WD40 374 413 1.5e-3 SMART
WD40 419 465 4.4e-2 SMART
Blast:WD40 493 526 5e-13 BLAST
WD40 530 570 9.3e-9 SMART
WD40 575 612 6e-3 SMART
WD40 623 659 1.4e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dynein intermediate chain family. The encoded protein is part of the dynein complex in respiratory cilia. The inner- and outer-arm dyneins, which bridge between the doublet microtubules in axonemes, are the force-generating proteins responsible for the sliding movement in axonemes. The intermediate and light chains, thought to form the base of the dynein arm, help mediate attachment and may also participate in regulating dynein activity. Mutations in this gene result in abnormal ciliary ultrastructure and function associated with primary ciliary dyskinesia and Kartagener syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutant mice exhibit situs inversus, heterotaxia and ciliary dyskinesia including cardiovascular defects and decreased ciliary activity in the trachea, reduced to absent mucociliary clearance, and chronic rhinosinusitis. Hydrocephaly is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Dnaic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Dnaic1 APN 4 41602917 missense probably benign 0.03
IGL02825:Dnaic1 APN 4 41625101 splice site probably benign
IGL03072:Dnaic1 APN 4 41602979 missense probably benign 0.00
H8562:Dnaic1 UTSW 4 41629833 missense possibly damaging 0.81
R0114:Dnaic1 UTSW 4 41605686 splice site probably benign
R0138:Dnaic1 UTSW 4 41629814 missense possibly damaging 0.49
R0153:Dnaic1 UTSW 4 41635162 unclassified probably benign
R0465:Dnaic1 UTSW 4 41629988 unclassified probably null
R0550:Dnaic1 UTSW 4 41596274 nonsense probably null
R0555:Dnaic1 UTSW 4 41625335 missense possibly damaging 0.64
R0890:Dnaic1 UTSW 4 41604253 missense possibly damaging 0.69
R0928:Dnaic1 UTSW 4 41602566 missense possibly damaging 0.57
R0944:Dnaic1 UTSW 4 41629997 missense probably benign
R1714:Dnaic1 UTSW 4 41632164 missense probably benign 0.12
R1902:Dnaic1 UTSW 4 41625319 nonsense probably null
R1919:Dnaic1 UTSW 4 41570020 critical splice donor site probably null
R1983:Dnaic1 UTSW 4 41603232 missense probably benign
R2036:Dnaic1 UTSW 4 41632225 missense probably damaging 1.00
R2306:Dnaic1 UTSW 4 41625239 missense probably benign
R2925:Dnaic1 UTSW 4 41597919 missense probably damaging 1.00
R3404:Dnaic1 UTSW 4 41603246 missense probably benign 0.00
R3720:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3721:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3722:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3931:Dnaic1 UTSW 4 41604229 missense probably damaging 1.00
R4330:Dnaic1 UTSW 4 41637966 missense probably damaging 1.00
R4755:Dnaic1 UTSW 4 41610269 missense probably damaging 0.99
R4905:Dnaic1 UTSW 4 41614269 missense probably benign 0.05
R4997:Dnaic1 UTSW 4 41597919 missense possibly damaging 0.80
R5088:Dnaic1 UTSW 4 41597630 missense probably benign 0.00
R5088:Dnaic1 UTSW 4 41632251 missense probably benign 0.02
R5970:Dnaic1 UTSW 4 41625281 missense probably benign 0.14
R5987:Dnaic1 UTSW 4 41632391 missense probably benign 0.03
R6247:Dnaic1 UTSW 4 41605775 missense probably benign
R6874:Dnaic1 UTSW 4 41632412 missense probably damaging 1.00
R6914:Dnaic1 UTSW 4 41625176 missense probably benign 0.01
R7508:Dnaic1 UTSW 4 41614323 missense probably benign 0.01
R7831:Dnaic1 UTSW 4 41614695 critical splice donor site probably null
R7832:Dnaic1 UTSW 4 41605823 missense probably benign 0.42
R7914:Dnaic1 UTSW 4 41614695 critical splice donor site probably null
R7915:Dnaic1 UTSW 4 41605823 missense probably benign 0.42
R8065:Dnaic1 UTSW 4 41614258 missense probably damaging 1.00
R8067:Dnaic1 UTSW 4 41614258 missense probably damaging 1.00
X0065:Dnaic1 UTSW 4 41629868 missense possibly damaging 0.89
Z1176:Dnaic1 UTSW 4 41614323 missense probably benign 0.32
Z1177:Dnaic1 UTSW 4 41569809 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCTCTACAGCATGAAGAACCCTAG -3'
(R):5'- AGCTTATGGGCAGCAGACTC -3'

Sequencing Primer
(F):5'- GAACCCTAGCTTTCCCGAGTACATG -3'
(R):5'- GCTCGGAAAGAAAACTGTCTC -3'
Posted On2018-08-01