Incidental Mutation 'R6727:Slc4a4'
ID529900
Institutional Source Beutler Lab
Gene Symbol Slc4a4
Ensembl Gene ENSMUSG00000060961
Gene Namesolute carrier family 4 (anion exchanger), member 4
SynonymsNBC1, NBC
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location88886818-89239653 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 89170765 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 640 (S640A)
Ref Sequence ENSEMBL: ENSMUSP00000121744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000148750] [ENSMUST00000156238]
Predicted Effect probably benign
Transcript: ENSMUST00000113218
AA Change: S631A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: S631A

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 379 1.1e-100 PFAM
low complexity region 408 423 N/A INTRINSIC
Pfam:HCO3_cotransp 426 947 3e-246 PFAM
transmembrane domain 953 975 N/A INTRINSIC
low complexity region 999 1015 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130041
AA Change: S596A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: S596A

DomainStartEndE-ValueType
Pfam:Band_3_cyto 93 344 1.5e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
Pfam:HCO3_cotransp 391 912 2.7e-246 PFAM
transmembrane domain 918 940 N/A INTRINSIC
low complexity region 964 980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148750
AA Change: S640A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: S640A

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 3.7e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 435 956 7.3e-246 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156238
AA Change: S640A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: S640A

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 4.6e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 436 956 4.1e-231 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Slc4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Slc4a4 APN 5 89179686 missense probably benign 0.01
IGL00976:Slc4a4 APN 5 88954798 missense probably damaging 1.00
IGL01074:Slc4a4 APN 5 89179774 missense probably damaging 1.00
IGL01120:Slc4a4 APN 5 89132379 missense probably damaging 1.00
IGL01284:Slc4a4 APN 5 89129673 missense probably benign 0.22
IGL01375:Slc4a4 APN 5 89179734 missense probably damaging 1.00
IGL01399:Slc4a4 APN 5 89228935 missense probably damaging 1.00
IGL01487:Slc4a4 APN 5 89228856 missense probably benign 0.19
IGL02501:Slc4a4 APN 5 89129649 missense probably benign 0.13
IGL03104:Slc4a4 APN 5 89149372 missense probably damaging 1.00
IGL03157:Slc4a4 APN 5 89156513 missense probably damaging 0.99
IGL03205:Slc4a4 APN 5 89149330 missense probably benign 0.00
IGL03356:Slc4a4 APN 5 89122483 missense probably benign 0.00
IGL03372:Slc4a4 APN 5 89156426 missense probably damaging 1.00
IGL03382:Slc4a4 APN 5 89228836 missense probably damaging 1.00
camera UTSW 5 89132507 missense probably damaging 1.00
pixels UTSW 5 89122403 missense probably damaging 0.99
Shutter UTSW 5 89225948 missense probably damaging 1.00
Tetrapod UTSW 5 89228972 missense probably damaging 1.00
tripod UTSW 5 89149333 missense possibly damaging 0.52
PIT4515001:Slc4a4 UTSW 5 89133253 missense probably damaging 1.00
PIT4544001:Slc4a4 UTSW 5 89038543 missense probably damaging 1.00
R0007:Slc4a4 UTSW 5 89038578 missense probably damaging 1.00
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0054:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0055:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0230:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0632:Slc4a4 UTSW 5 89129641 missense probably damaging 1.00
R1199:Slc4a4 UTSW 5 89215794 critical splice donor site probably null
R1597:Slc4a4 UTSW 5 89135728 missense probably benign 0.01
R1783:Slc4a4 UTSW 5 89132414 missense probably damaging 1.00
R1813:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R1896:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R2000:Slc4a4 UTSW 5 89028347 missense probably damaging 1.00
R2139:Slc4a4 UTSW 5 89046264 missense probably damaging 1.00
R2163:Slc4a4 UTSW 5 89214576 missense probably damaging 1.00
R2513:Slc4a4 UTSW 5 89156398 missense probably benign 0.00
R2873:Slc4a4 UTSW 5 89135764 missense probably damaging 1.00
R2995:Slc4a4 UTSW 5 88934814 missense probably damaging 1.00
R3054:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89132507 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3056:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3617:Slc4a4 UTSW 5 89234804 missense probably benign 0.00
R3856:Slc4a4 UTSW 5 89232839 missense probably benign 0.00
R3863:Slc4a4 UTSW 5 89135648 missense possibly damaging 0.95
R3896:Slc4a4 UTSW 5 89197766 splice site probably benign
R4007:Slc4a4 UTSW 5 89214593 missense probably damaging 1.00
R4616:Slc4a4 UTSW 5 89038561 missense probably damaging 1.00
R4740:Slc4a4 UTSW 5 89225894 missense probably damaging 1.00
R5009:Slc4a4 UTSW 5 89149298 critical splice acceptor site probably null
R5119:Slc4a4 UTSW 5 88954862 missense probably null 0.97
R5228:Slc4a4 UTSW 5 89156525 missense possibly damaging 0.50
R5394:Slc4a4 UTSW 5 89197764 critical splice donor site probably null
R5396:Slc4a4 UTSW 5 89046217 missense probably benign 0.00
R5662:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R5664:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R6021:Slc4a4 UTSW 5 89040402 intron probably benign
R6088:Slc4a4 UTSW 5 89197704 missense probably benign 0.12
R6337:Slc4a4 UTSW 5 89046372 missense probably benign 0.21
R6416:Slc4a4 UTSW 5 89179729 missense probably benign 0.26
R6452:Slc4a4 UTSW 5 89228980 missense probably benign 0.05
R6524:Slc4a4 UTSW 5 89232764 missense probably benign 0.01
R6566:Slc4a4 UTSW 5 89149333 missense possibly damaging 0.52
R6844:Slc4a4 UTSW 5 89228972 missense probably damaging 1.00
R6970:Slc4a4 UTSW 5 89179831 missense probably damaging 0.98
R7021:Slc4a4 UTSW 5 89040346 splice site probably null
R7180:Slc4a4 UTSW 5 89046236 missense probably damaging 0.97
R7197:Slc4a4 UTSW 5 88934574 intron probably benign
R7246:Slc4a4 UTSW 5 89122403 missense probably damaging 0.99
R7309:Slc4a4 UTSW 5 89170751 missense probably benign
R7412:Slc4a4 UTSW 5 89214647 synonymous probably null
R7492:Slc4a4 UTSW 5 89129650 missense possibly damaging 0.92
R7561:Slc4a4 UTSW 5 89199697 missense probably damaging 1.00
R7577:Slc4a4 UTSW 5 89225867 missense probably damaging 0.97
R7609:Slc4a4 UTSW 5 89135686 missense probably damaging 1.00
R7781:Slc4a4 UTSW 5 89228932 missense possibly damaging 0.78
R8078:Slc4a4 UTSW 5 89179707 missense probably benign 0.00
Z1177:Slc4a4 UTSW 5 89132459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGCCATACAATCCTGCTG -3'
(R):5'- CGCTAACTTAAAGCTGACATTCTG -3'

Sequencing Primer
(F):5'- ACAATCCTGCTGAAGGTTTTGTTTTG -3'
(R):5'- AAAGCTGACATTCTGTTTGTTCC -3'
Posted On2018-08-01