Incidental Mutation 'R6727:Cyp3a44'
ID529903
Institutional Source Beutler Lab
Gene Symbol Cyp3a44
Ensembl Gene ENSMUSG00000054417
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 44
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145773983-145805874 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 145794971 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 122 (K122*)
Ref Sequence ENSEMBL: ENSMUSP00000069932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067479]
Predicted Effect probably null
Transcript: ENSMUST00000067479
AA Change: K122*
SMART Domains Protein: ENSMUSP00000069932
Gene: ENSMUSG00000054417
AA Change: K122*

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:p450 38 494 2.4e-133 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Cyp3a44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Cyp3a44 APN 5 145774347 makesense probably null
IGL00972:Cyp3a44 APN 5 145779724 missense possibly damaging 0.84
IGL01062:Cyp3a44 APN 5 145794339 missense possibly damaging 0.88
IGL01072:Cyp3a44 APN 5 145791628 missense probably benign 0.01
IGL01515:Cyp3a44 APN 5 145799418 nonsense probably null
IGL01738:Cyp3a44 APN 5 145794935 missense probably damaging 1.00
IGL01869:Cyp3a44 APN 5 145790686 missense probably damaging 0.99
IGL02269:Cyp3a44 APN 5 145805737 missense probably benign 0.23
IGL02284:Cyp3a44 APN 5 145788369 missense possibly damaging 0.91
IGL02479:Cyp3a44 APN 5 145790667 missense probably benign 0.01
IGL02480:Cyp3a44 APN 5 145794905 missense possibly damaging 0.93
IGL02506:Cyp3a44 APN 5 145799388 missense probably damaging 1.00
IGL02957:Cyp3a44 APN 5 145779662 nonsense probably null
IGL02978:Cyp3a44 APN 5 145788398 missense probably damaging 0.98
R0427:Cyp3a44 UTSW 5 145779602 missense possibly damaging 0.85
R1240:Cyp3a44 UTSW 5 145774440 missense probably benign 0.02
R1247:Cyp3a44 UTSW 5 145791667 missense probably damaging 1.00
R1657:Cyp3a44 UTSW 5 145779743 missense probably damaging 0.99
R2096:Cyp3a44 UTSW 5 145788405 missense probably damaging 1.00
R2156:Cyp3a44 UTSW 5 145803670 nonsense probably null
R2412:Cyp3a44 UTSW 5 145779579 nonsense probably null
R4817:Cyp3a44 UTSW 5 145803755 missense possibly damaging 0.64
R4884:Cyp3a44 UTSW 5 145777982 missense probably damaging 1.00
R5266:Cyp3a44 UTSW 5 145794397 missense possibly damaging 0.66
R5301:Cyp3a44 UTSW 5 145788516 missense probably damaging 0.99
R5463:Cyp3a44 UTSW 5 145803744 missense probably benign 0.00
R5625:Cyp3a44 UTSW 5 145779566 missense possibly damaging 0.74
R5635:Cyp3a44 UTSW 5 145801314 missense possibly damaging 0.90
R5924:Cyp3a44 UTSW 5 145794327 missense possibly damaging 0.54
R5964:Cyp3a44 UTSW 5 145788467 missense possibly damaging 0.95
R5988:Cyp3a44 UTSW 5 145794918 missense probably damaging 1.00
R6011:Cyp3a44 UTSW 5 145801274 critical splice donor site probably null
R6032:Cyp3a44 UTSW 5 145777946 missense probably damaging 1.00
R6032:Cyp3a44 UTSW 5 145777946 missense probably damaging 1.00
R6413:Cyp3a44 UTSW 5 145794444 missense probably damaging 1.00
R6579:Cyp3a44 UTSW 5 145790706 missense probably damaging 0.99
R6587:Cyp3a44 UTSW 5 145805759 missense probably benign 0.23
R6709:Cyp3a44 UTSW 5 145778092 splice site probably null
R6825:Cyp3a44 UTSW 5 145779586 missense probably damaging 1.00
R7142:Cyp3a44 UTSW 5 145777961 missense probably benign 0.24
R7352:Cyp3a44 UTSW 5 145803688 missense probably benign 0.01
R8099:Cyp3a44 UTSW 5 145788402 missense probably benign 0.12
R8240:Cyp3a44 UTSW 5 145788447 missense probably damaging 0.99
Z1176:Cyp3a44 UTSW 5 145791664 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAGGCATGCCTTTCTCTGC -3'
(R):5'- CCCTGGACATAATTTTCCAACC -3'

Sequencing Primer
(F):5'- GCCTCAAGTACTTTACCAAAATGTC -3'
(R):5'- CTGGACATAATTTTCCAACCACAGTG -3'
Posted On2018-08-01