Incidental Mutation 'R6727:Tspan3'
ID529914
Institutional Source Beutler Lab
Gene Symbol Tspan3
Ensembl Gene ENSMUSG00000032324
Gene Nametetraspanin 3
SynonymsTM4-A, tetraspanin, Tm4sf8, tetraspanin TM4-A homolog, Tspan-3, 1700055K04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location56131725-56165477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56147440 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 108 (G108S)
Ref Sequence ENSEMBL: ENSMUSP00000148864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034876] [ENSMUST00000215906] [ENSMUST00000216320]
Predicted Effect probably damaging
Transcript: ENSMUST00000034876
AA Change: G68S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034876
Gene: ENSMUSG00000032324
AA Change: G68S

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 237 1.2e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214970
Predicted Effect probably damaging
Transcript: ENSMUST00000215906
AA Change: G71S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216317
Predicted Effect probably damaging
Transcript: ENSMUST00000216320
AA Change: G108S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The use of alternate polyadenylation sites has been found for this gene. Multiple alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased hematopoietic stem cell number and decreased leukemia incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Tspan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02880:Tspan3 APN 9 56146516 missense possibly damaging 0.78
R0585:Tspan3 UTSW 9 56145932 splice site probably benign
R0608:Tspan3 UTSW 9 56147385 critical splice donor site probably null
R1067:Tspan3 UTSW 9 56160820 missense probably benign 0.01
R1368:Tspan3 UTSW 9 56147499 missense probably benign 0.08
R4673:Tspan3 UTSW 9 56136696 missense probably damaging 1.00
R7701:Tspan3 UTSW 9 56147519 nonsense probably null
R7995:Tspan3 UTSW 9 56147154 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTAGAGGTTTAAGGCATGTG -3'
(R):5'- CTGAGCAAGAGTAGGAACTTCG -3'

Sequencing Primer
(F):5'- AGGCATGTGTTAATACTCTGGTATAG -3'
(R):5'- ACTTCGGGGTTGGGACTCAAAC -3'
Posted On2018-08-01