Incidental Mutation 'R6727:Me1'
ID529916
Institutional Source Beutler Lab
Gene Symbol Me1
Ensembl Gene ENSMUSG00000032418
Gene Namemalic enzyme 1, NADP(+)-dependent, cytosolic
SynonymsMod-1, Mdh-1, Mod1, D9Ertd267e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6727 (G1)
Quality Score176.009
Status Not validated
Chromosome9
Chromosomal Location86581371-86695953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86582798 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 533 (L533P)
Ref Sequence ENSEMBL: ENSMUSP00000140887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034989] [ENSMUST00000185374]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034989
AA Change: L553P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034989
Gene: ENSMUSG00000032418
AA Change: L553P

DomainStartEndE-ValueType
malic 79 260 7.34e-106 SMART
Malic_M 270 522 1.09e-111 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185374
AA Change: L533P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140887
Gene: ENSMUSG00000032418
AA Change: L533P

DomainStartEndE-ValueType
malic 59 240 7.34e-106 SMART
Malic_M 250 502 1.09e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189968
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic, NADP-dependent enzyme that generates NADPH for fatty acid biosynthesis. The activity of this enzyme, the reversible oxidative decarboxylation of malate, links the glycolytic and citric acid cycles. The regulation of expression for this gene is complex. Increased expression can result from elevated levels of thyroid hormones or by higher proportions of carbohydrates in the diet. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit decreased body weight on a medium fat diet, altered cytoplasmic malic enzyme activity, and a male-specific reduction in food intake on a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Me1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Me1 APN 9 86598748 missense probably damaging 1.00
IGL01326:Me1 APN 9 86598718 critical splice donor site probably null
IGL02231:Me1 APN 9 86611855 missense possibly damaging 0.92
IGL02343:Me1 APN 9 86654641 critical splice donor site probably null
IGL02444:Me1 APN 9 86582914 splice site probably benign
IGL02655:Me1 APN 9 86654727 splice site probably benign
IGL03282:Me1 APN 9 86613596 missense probably damaging 0.99
R0116:Me1 UTSW 9 86654667 missense probably benign 0.01
R0270:Me1 UTSW 9 86596204 splice site probably benign
R0361:Me1 UTSW 9 86651002 missense probably damaging 1.00
R1535:Me1 UTSW 9 86587043 missense probably damaging 0.96
R1601:Me1 UTSW 9 86678012 missense probably damaging 1.00
R1807:Me1 UTSW 9 86650879 missense probably damaging 0.98
R2085:Me1 UTSW 9 86613554 missense probably damaging 1.00
R2571:Me1 UTSW 9 86654698 missense probably damaging 1.00
R3012:Me1 UTSW 9 86611912 missense probably benign 0.00
R4649:Me1 UTSW 9 86679852 missense probably benign 0.00
R5540:Me1 UTSW 9 86679873 missense possibly damaging 0.60
R6129:Me1 UTSW 9 86650956 missense probably damaging 1.00
R7718:Me1 UTSW 9 86679900 missense probably damaging 1.00
RF001:Me1 UTSW 9 86582823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTCTGGTGTGAAATTTATCC -3'
(R):5'- TGCTACATCTGATTCATAGCTGC -3'

Sequencing Primer
(F):5'- TCCTAATAGACTCCCATGAG -3'
(R):5'- ACATCTGATTCATAGCTGCATTTTC -3'
Posted On2018-08-01