Incidental Mutation 'R6727:Slc25a17'
ID529927
Institutional Source Beutler Lab
Gene Symbol Slc25a17
Ensembl Gene ENSMUSG00000022404
Gene Namesolute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), member 17
Synonyms34kDa, PMP34
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location81318911-81360812 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81337953 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 106 (V106A)
Ref Sequence ENSEMBL: ENSMUSP00000155823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023040] [ENSMUST00000230309] [ENSMUST00000231140]
Predicted Effect probably benign
Transcript: ENSMUST00000023040
AA Change: V106A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023040
Gene: ENSMUSG00000022404
AA Change: V106A

DomainStartEndE-ValueType
Pfam:Mito_carr 6 97 1e-17 PFAM
Pfam:Mito_carr 97 197 6.3e-24 PFAM
Pfam:Mito_carr 199 297 3.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229617
Predicted Effect probably benign
Transcript: ENSMUST00000230309
Predicted Effect probably benign
Transcript: ENSMUST00000230983
Predicted Effect probably benign
Transcript: ENSMUST00000231140
AA Change: V106A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peroxisomal membrane protein that belongs to the family of mitochondrial solute carriers. It is expressed in the liver, and is likely involved in transport. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Slc25a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Slc25a17 APN 15 81327326 nonsense probably null
IGL02655:Slc25a17 APN 15 81323643 missense probably benign 0.02
IGL03258:Slc25a17 APN 15 81329042 splice site probably benign
big_guy UTSW 15 81360774 utr 5 prime probably benign
R0114:Slc25a17 UTSW 15 81337959 missense probably damaging 1.00
R0763:Slc25a17 UTSW 15 81323706 splice site probably benign
R1628:Slc25a17 UTSW 15 81360724 missense possibly damaging 0.92
R2179:Slc25a17 UTSW 15 81337950 missense probably benign 0.02
R3420:Slc25a17 UTSW 15 81360700 missense probably benign 0.04
R3421:Slc25a17 UTSW 15 81360700 missense probably benign 0.04
R3687:Slc25a17 UTSW 15 81327284 missense probably benign 0.01
R3688:Slc25a17 UTSW 15 81327284 missense probably benign 0.01
R4707:Slc25a17 UTSW 15 81327326 missense probably damaging 0.97
R5617:Slc25a17 UTSW 15 81360774 utr 5 prime probably benign
R5650:Slc25a17 UTSW 15 81329176 splice site probably null
R5817:Slc25a17 UTSW 15 81327060 missense probably damaging 0.97
R6207:Slc25a17 UTSW 15 81329064 missense probably damaging 1.00
R7331:Slc25a17 UTSW 15 81329145 missense probably damaging 1.00
R8101:Slc25a17 UTSW 15 81338047 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTACACAGAGAAACCCTG -3'
(R):5'- GCCCATGGCTTTTGTTCATG -3'

Sequencing Primer
(F):5'- GAGAAACCCTGTCTCAAAAATACC -3'
(R):5'- CATGGCTTTTGTTCATGATCTTTAC -3'
Posted On2018-08-01