Incidental Mutation 'R6727:Kcnj15'
ID529928
Institutional Source Beutler Lab
Gene Symbol Kcnj15
Ensembl Gene ENSMUSG00000062609
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 15
SynonymsKir4.2, IRKK, 4930414N08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location95257558-95300260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95296334 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 272 (S272G)
Ref Sequence ENSEMBL: ENSMUSP00000109493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037154] [ENSMUST00000113854] [ENSMUST00000113855] [ENSMUST00000113856] [ENSMUST00000113858] [ENSMUST00000113859] [ENSMUST00000113861] [ENSMUST00000113862] [ENSMUST00000125847] [ENSMUST00000134166] [ENSMUST00000138329] [ENSMUST00000140222] [ENSMUST00000152516]
Predicted Effect probably damaging
Transcript: ENSMUST00000037154
AA Change: S272G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045218
Gene: ENSMUSG00000062609
AA Change: S272G

DomainStartEndE-ValueType
Pfam:IRK 57 384 4.4e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113854
AA Change: S245G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109485
Gene: ENSMUSG00000062609
AA Change: S245G

DomainStartEndE-ValueType
Pfam:IRK 30 365 2.5e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113855
AA Change: S245G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109486
Gene: ENSMUSG00000062609
AA Change: S245G

DomainStartEndE-ValueType
Pfam:IRK 30 365 2.5e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113856
AA Change: S245G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109487
Gene: ENSMUSG00000062609
AA Change: S245G

DomainStartEndE-ValueType
Pfam:IRK 30 365 2.5e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113858
AA Change: S245G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109489
Gene: ENSMUSG00000062609
AA Change: S245G

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113859
AA Change: S272G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109490
Gene: ENSMUSG00000062609
AA Change: S272G

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113861
AA Change: S272G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109492
Gene: ENSMUSG00000062609
AA Change: S272G

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113862
AA Change: S272G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109493
Gene: ENSMUSG00000062609
AA Change: S272G

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125847
Predicted Effect probably benign
Transcript: ENSMUST00000134166
SMART Domains Protein: ENSMUSP00000118992
Gene: ENSMUSG00000062609

DomainStartEndE-ValueType
Pfam:IRK 57 173 8.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138329
Predicted Effect probably benign
Transcript: ENSMUST00000140222
Predicted Effect probably benign
Transcript: ENSMUST00000152516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232622
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Eight transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous knockout mice exhibited impaired balance/coordination in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Kcnj15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Kcnj15 APN 16 95296463 missense probably damaging 1.00
IGL03096:Kcnj15 APN 16 95296434 missense probably damaging 1.00
R1117:Kcnj15 UTSW 16 95295625 missense probably benign 0.28
R3911:Kcnj15 UTSW 16 95296470 missense probably damaging 1.00
R3913:Kcnj15 UTSW 16 95296470 missense probably damaging 1.00
R3928:Kcnj15 UTSW 16 95296509 missense possibly damaging 0.95
R4155:Kcnj15 UTSW 16 95296307 nonsense probably null
R4613:Kcnj15 UTSW 16 95295794 missense probably damaging 1.00
R5334:Kcnj15 UTSW 16 95296649 missense probably damaging 1.00
R6151:Kcnj15 UTSW 16 95295668 nonsense probably null
R6334:Kcnj15 UTSW 16 95296236 missense probably damaging 1.00
R6446:Kcnj15 UTSW 16 95296259 missense probably benign 0.00
R7070:Kcnj15 UTSW 16 95295831 missense probably damaging 1.00
Z1088:Kcnj15 UTSW 16 95296119 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGAGCCGAGACCATTAAG -3'
(R):5'- AGTAGATCTCCTCCGGGATGTAAG -3'

Sequencing Primer
(F):5'- GAGACCATTAAGTTCAGCCACTGTG -3'
(R):5'- TCCTCCGGGATGTAAGACGTTC -3'
Posted On2018-08-01