Incidental Mutation 'R6727:4933408B17Rik'
ID529931
Institutional Source Beutler Lab
Gene Symbol 4933408B17Rik
Ensembl Gene ENSMUSG00000049357
Gene NameRIKEN cDNA 4933408B17 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location34579846-34597468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34580841 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 244 (M244L)
Ref Sequence ENSEMBL: ENSMUSP00000054234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056932] [ENSMUST00000079287] [ENSMUST00000129566] [ENSMUST00000134875] [ENSMUST00000154342] [ENSMUST00000155114]
Predicted Effect probably benign
Transcript: ENSMUST00000056932
AA Change: M244L

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054234
Gene: ENSMUSG00000049357
AA Change: M244L

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 47 65 N/A INTRINSIC
low complexity region 77 86 N/A INTRINSIC
BROMO 153 261 8.66e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079287
SMART Domains Protein: ENSMUSP00000078269
Gene: ENSMUSG00000035984

DomainStartEndE-ValueType
NDK 12 150 1.9e-62 SMART
Pfam:Dpy-30 156 197 7.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129566
SMART Domains Protein: ENSMUSP00000117272
Gene: ENSMUSG00000049357

DomainStartEndE-ValueType
Blast:BROMO 20 197 5e-25 BLAST
SCOP:d1f68a_ 161 204 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134875
SMART Domains Protein: ENSMUSP00000118213
Gene: ENSMUSG00000035984

DomainStartEndE-ValueType
NDK 12 113 2.91e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154342
SMART Domains Protein: ENSMUSP00000117443
Gene: ENSMUSG00000035984

DomainStartEndE-ValueType
NDK 12 113 2.91e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155114
Meta Mutation Damage Score 0.1577 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in 4933408B17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02554:4933408B17Rik APN 18 34593015 missense probably benign 0.01
R0110:4933408B17Rik UTSW 18 34596151 missense probably damaging 0.96
R0510:4933408B17Rik UTSW 18 34596151 missense probably damaging 0.96
R0633:4933408B17Rik UTSW 18 34586266 missense possibly damaging 0.56
R1138:4933408B17Rik UTSW 18 34580244 missense probably benign 0.09
R4768:4933408B17Rik UTSW 18 34580952 missense probably damaging 1.00
R6670:4933408B17Rik UTSW 18 34586266 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATCCGGATCCATTAAGACAAGG -3'
(R):5'- CCTTACATACTAAGGTTGGATTTCC -3'

Sequencing Primer
(F):5'- CAAGAGTACCTTGGTCCTTCAGG -3'
(R):5'- ACATACTAAGGTTGGATTTCCTCTGG -3'
Posted On2018-08-01