Incidental Mutation 'R6727:Cfap58'
ID529932
Institutional Source Beutler Lab
Gene Symbol Cfap58
Ensembl Gene ENSMUSG00000046585
Gene Namecilia and flagella associated protein 58
SynonymsLOC381229, Ccdc147
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location47937712-48035379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47955417 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 352 (D352V)
Ref Sequence ENSEMBL: ENSMUSP00000070533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066308]
Predicted Effect probably benign
Transcript: ENSMUST00000066308
AA Change: D352V

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000070533
Gene: ENSMUSG00000046585
AA Change: D352V

DomainStartEndE-ValueType
coiled coil region 106 579 N/A INTRINSIC
coiled coil region 642 706 N/A INTRINSIC
low complexity region 740 762 N/A INTRINSIC
coiled coil region 772 832 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Cfap58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Cfap58 APN 19 47974567 missense probably benign 0.30
IGL02068:Cfap58 APN 19 47986512 missense probably damaging 1.00
IGL02609:Cfap58 APN 19 47975502 missense possibly damaging 0.80
IGL03376:Cfap58 APN 19 48034725 missense possibly damaging 0.60
PIT4515001:Cfap58 UTSW 19 48034683 missense probably benign
PIT4618001:Cfap58 UTSW 19 47975514 missense probably damaging 1.00
R0015:Cfap58 UTSW 19 48029100 missense probably benign 0.45
R0015:Cfap58 UTSW 19 48029100 missense probably benign 0.45
R0454:Cfap58 UTSW 19 47974680 critical splice donor site probably null
R0545:Cfap58 UTSW 19 47941097 splice site probably benign
R0789:Cfap58 UTSW 19 47955309 missense probably benign 0.09
R0926:Cfap58 UTSW 19 47962562 missense probably damaging 0.96
R1148:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1148:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1462:Cfap58 UTSW 19 47962430 missense probably damaging 1.00
R1462:Cfap58 UTSW 19 47962430 missense probably damaging 1.00
R1493:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1541:Cfap58 UTSW 19 47983530 missense probably damaging 1.00
R1629:Cfap58 UTSW 19 47941339 missense probably benign 0.02
R1648:Cfap58 UTSW 19 47955405 missense probably benign 0.13
R1837:Cfap58 UTSW 19 48029139 missense probably damaging 0.98
R2307:Cfap58 UTSW 19 47962486 nonsense probably null
R2513:Cfap58 UTSW 19 47962542 missense probably benign 0.03
R3802:Cfap58 UTSW 19 47953059 missense possibly damaging 0.81
R4233:Cfap58 UTSW 19 47975555 missense possibly damaging 0.60
R4258:Cfap58 UTSW 19 47949484 splice site probably null
R4414:Cfap58 UTSW 19 47953041 missense possibly damaging 0.87
R4763:Cfap58 UTSW 19 47983506 missense probably damaging 1.00
R5300:Cfap58 UTSW 19 47941156 missense probably benign 0.09
R5406:Cfap58 UTSW 19 48029102 missense possibly damaging 0.81
R5497:Cfap58 UTSW 19 48029109 missense probably benign 0.08
R5635:Cfap58 UTSW 19 47983542 missense possibly damaging 0.47
R6315:Cfap58 UTSW 19 47941277 missense probably benign 0.40
R6483:Cfap58 UTSW 19 47983452 missense probably benign 0.00
R6896:Cfap58 UTSW 19 47944187 missense probably damaging 0.98
R7461:Cfap58 UTSW 19 47982122 missense possibly damaging 0.70
R7473:Cfap58 UTSW 19 47974625 nonsense probably null
R7613:Cfap58 UTSW 19 47982122 missense possibly damaging 0.70
R7650:Cfap58 UTSW 19 47986528 missense possibly damaging 0.84
R8083:Cfap58 UTSW 19 47983518 missense probably damaging 1.00
R8121:Cfap58 UTSW 19 48029104 missense probably benign 0.40
R8321:Cfap58 UTSW 19 47958147 missense probably damaging 0.99
X0067:Cfap58 UTSW 19 47955308 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATTGGTTCAGCATCCCAG -3'
(R):5'- TTAGACTCCCATGGTGCCAC -3'

Sequencing Primer
(F):5'- GGTTCAGCATCCCAGCTAATTC -3'
(R):5'- TTTACAGCCTTGGAAACAGTGG -3'
Posted On2018-08-01