Incidental Mutation 'R6728:Kin'
ID529934
Institutional Source Beutler Lab
Gene Symbol Kin
Ensembl Gene ENSMUSG00000037262
Gene NameKin17 DNA and RNA binding protein
SynonymsKin17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R6728 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location10080593-10092806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10090148 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 82 (R82Q)
Ref Sequence ENSEMBL: ENSMUSP00000043614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042290] [ENSMUST00000042512]
Predicted Effect probably benign
Transcript: ENSMUST00000042290
SMART Domains Protein: ENSMUSP00000046530
Gene: ENSMUSG00000037254

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VIT 60 189 4.35e-77 SMART
VWA 312 498 6.6e-32 SMART
Pfam:ITI_HC_C 740 925 1.7e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000042512
AA Change: R82Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043614
Gene: ENSMUSG00000037262
AA Change: R82Q

DomainStartEndE-ValueType
ZnF_C2H2 26 50 2.35e1 SMART
Kin17_mid 52 178 5.41e-89 SMART
low complexity region 209 224 N/A INTRINSIC
low complexity region 242 258 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
KOW 334 361 1.97e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142773
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that forms intranuclear foci during proliferation and is redistributed in the nucleoplasm during the cell cycle. Short-wave ultraviolet light provokes the relocalization of the protein, suggesting its participation in the cellular response to DNA damage. Originally selected based on protein-binding with RecA antibodies, the mouse protein presents a limited similarity with a functional domain of the bacterial RecA protein, a characteristic shared by this human ortholog. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adcy5 T A 16: 35,157,165 V356E possibly damaging Het
Agmat G T 4: 141,749,586 C101F probably benign Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Cyp17a1 A G 19: 46,669,234 V293A probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr1277 A T 2: 111,269,673 D231E probably benign Het
Olfr749 T C 14: 50,736,839 T108A possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Platr25 G A 13: 62,700,383 H222Y probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vegfc T C 8: 54,186,022 V401A probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Kin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Kin APN 2 10080704 missense probably damaging 1.00
IGL00898:Kin APN 2 10080706 missense probably damaging 1.00
IGL00907:Kin APN 2 10080704 missense probably damaging 1.00
IGL00907:Kin APN 2 10080706 missense probably damaging 1.00
IGL00941:Kin APN 2 10080704 missense probably damaging 1.00
IGL00941:Kin APN 2 10080706 missense probably damaging 1.00
IGL00971:Kin APN 2 10090348 missense possibly damaging 0.88
IGL01570:Kin APN 2 10091952 missense probably benign 0.05
R0090:Kin UTSW 2 10085773 missense possibly damaging 0.53
R0656:Kin UTSW 2 10085720 splice site probably benign
R0827:Kin UTSW 2 10090376 splice site probably benign
R1530:Kin UTSW 2 10092339 missense probably damaging 1.00
R4879:Kin UTSW 2 10080644 missense probably benign 0.01
R7191:Kin UTSW 2 10091793 missense probably benign 0.32
R7209:Kin UTSW 2 10091753 missense possibly damaging 0.46
R7242:Kin UTSW 2 10091793 missense probably benign 0.32
R7650:Kin UTSW 2 10092168 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAAAGCCAATCTTCGCAGATC -3'
(R):5'- AAAGTCGGTCAGTGTCTCCC -3'

Sequencing Primer
(F):5'- AAAGCCAATCTTCGCAGATCTTTCTC -3'
(R):5'- TCCCACTGGGTAGCGTTCATG -3'
Posted On2018-08-01