Incidental Mutation 'R6728:Olfr1277'
ID529936
Institutional Source Beutler Lab
Gene Symbol Olfr1277
Ensembl Gene ENSMUSG00000074965
Gene Nameolfactory receptor 1277
SynonymsMOR248-11, GA_x6K02T2Q125-72321818-72320907
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6728 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111264946-111274106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111269673 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 231 (D231E)
Ref Sequence ENSEMBL: ENSMUSP00000150703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099619] [ENSMUST00000214760]
Predicted Effect probably benign
Transcript: ENSMUST00000099619
AA Change: D231E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097214
Gene: ENSMUSG00000074965
AA Change: D231E

DomainStartEndE-ValueType
Pfam:7tm_4 31 303 5.5e-50 PFAM
Pfam:7tm_1 41 287 7.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214760
AA Change: D231E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adcy5 T A 16: 35,157,165 V356E possibly damaging Het
Agmat G T 4: 141,749,586 C101F probably benign Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Cyp17a1 A G 19: 46,669,234 V293A probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kin G A 2: 10,090,148 R82Q possibly damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr749 T C 14: 50,736,839 T108A possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Platr25 G A 13: 62,700,383 H222Y probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vegfc T C 8: 54,186,022 V401A probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Olfr1277
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Olfr1277 APN 2 111269912 missense probably damaging 1.00
IGL02550:Olfr1277 APN 2 111270004 missense probably damaging 0.99
IGL02661:Olfr1277 APN 2 111269466 missense possibly damaging 0.56
IGL02940:Olfr1277 APN 2 111269728 missense probably damaging 0.99
R0121:Olfr1277 UTSW 2 111270314 missense probably benign 0.01
R0402:Olfr1277 UTSW 2 111269863 missense probably damaging 1.00
R0903:Olfr1277 UTSW 2 111270356 missense probably benign
R1804:Olfr1277 UTSW 2 111269930 missense probably benign
R1806:Olfr1277 UTSW 2 111270277 missense possibly damaging 0.65
R1965:Olfr1277 UTSW 2 111269593 missense probably damaging 1.00
R3718:Olfr1277 UTSW 2 111270226 missense probably benign
R4044:Olfr1277 UTSW 2 111269582 missense probably benign 0.01
R4401:Olfr1277 UTSW 2 111269833 missense probably damaging 1.00
R4518:Olfr1277 UTSW 2 111269918 missense probably benign
R5309:Olfr1277 UTSW 2 111270310 missense probably benign 0.00
R5312:Olfr1277 UTSW 2 111270310 missense probably benign 0.00
R5367:Olfr1277 UTSW 2 111269890 missense possibly damaging 0.81
R5727:Olfr1277 UTSW 2 111269852 nonsense probably null
R5772:Olfr1277 UTSW 2 111269712 nonsense probably null
R5827:Olfr1277 UTSW 2 111269921 missense probably damaging 1.00
R5882:Olfr1277 UTSW 2 111270139 missense probably damaging 0.99
R6036:Olfr1277 UTSW 2 111269612 missense probably damaging 1.00
R6036:Olfr1277 UTSW 2 111269612 missense probably damaging 1.00
R7629:Olfr1277 UTSW 2 111269876 missense probably benign 0.00
R8377:Olfr1277 UTSW 2 111269638 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCGTTTGCTAGCATTGTAATCTC -3'
(R):5'- TTGTAAATCTGCCCTTCTGTGG -3'

Sequencing Primer
(F):5'- GCTAGCATTGTAATCTCTTCATAGC -3'
(R):5'- TGCCCTTCTGTGGATCCAGAG -3'
Posted On2018-08-01