Incidental Mutation 'R6728:Acot11'
ID529942
Institutional Source Beutler Lab
Gene Symbol Acot11
Ensembl Gene ENSMUSG00000034853
Gene Nameacyl-CoA thioesterase 11
SynonymsThea, Them1, 2010309H15Rik, 1110020M10Rik, BFIT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6728 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location106744555-106804998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106760130 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 240 (G240R)
Ref Sequence ENSEMBL: ENSMUSP00000099823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065253] [ENSMUST00000102762] [ENSMUST00000140541] [ENSMUST00000145061] [ENSMUST00000148688] [ENSMUST00000156567]
Predicted Effect probably damaging
Transcript: ENSMUST00000065253
AA Change: G260R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069636
Gene: ENSMUSG00000034853
AA Change: G260R

DomainStartEndE-ValueType
Pfam:4HBT 84 157 7e-10 PFAM
Pfam:4HBT 255 331 2.6e-13 PFAM
START 405 603 1.49e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102762
AA Change: G240R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099823
Gene: ENSMUSG00000034853
AA Change: G240R

DomainStartEndE-ValueType
Pfam:4HBT 64 136 7.2e-10 PFAM
Pfam:4HBT 235 311 6.7e-13 PFAM
START 385 583 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140541
SMART Domains Protein: ENSMUSP00000124567
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 32 71 3e-10 PDB
SCOP:d1lo7a_ 37 69 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144809
Predicted Effect probably benign
Transcript: ENSMUST00000145061
SMART Domains Protein: ENSMUSP00000125123
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
Pfam:4HBT 49 107 4.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148688
SMART Domains Protein: ENSMUSP00000124385
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 28 93 6e-23 PDB
SCOP:d1lo7a_ 33 93 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156567
SMART Domains Protein: ENSMUSP00000123942
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 43 89 8e-11 PDB
SCOP:d1lo7a_ 48 80 2e-3 SMART
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA thioesterase family which catalyse the conversion of activated fatty acids to the corresponding non-esterified fatty acid and coenzyme A. Expression of a mouse homolog in brown adipose tissue is induced by low temperatures and repressed by warm temperatures. Higher levels of expression of the mouse homolog has been found in obesity-resistant mice compared with obesity-prone mice, suggesting a role of acyl-CoA thioesterase 11 in obesity. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a null mutation display resistance to high fat diet induced obesity, inflammation and hepatic steatosis, increased energy expenditure, increased brown adipose tissue amount, and increased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Adcy5 T A 16: 35,157,165 V356E possibly damaging Het
Agmat G T 4: 141,749,586 C101F probably benign Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Cyp17a1 A G 19: 46,669,234 V293A probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kin G A 2: 10,090,148 R82Q possibly damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr1277 A T 2: 111,269,673 D231E probably benign Het
Olfr749 T C 14: 50,736,839 T108A possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Platr25 G A 13: 62,700,383 H222Y probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vegfc T C 8: 54,186,022 V401A probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Acot11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Acot11 APN 4 106771484 missense probably benign 0.00
IGL01896:Acot11 APN 4 106771367 missense probably damaging 1.00
IGL02408:Acot11 APN 4 106758381 missense probably damaging 1.00
IGL03053:Acot11 APN 4 106755853 nonsense probably null
IGL03156:Acot11 APN 4 106754136 missense probably damaging 1.00
R0266:Acot11 UTSW 4 106749988 missense probably damaging 0.99
R0485:Acot11 UTSW 4 106762027 missense probably damaging 1.00
R0537:Acot11 UTSW 4 106762455 missense probably benign 0.10
R0707:Acot11 UTSW 4 106760132 missense probably damaging 1.00
R0969:Acot11 UTSW 4 106760080 critical splice donor site probably null
R1109:Acot11 UTSW 4 106749348 missense probably benign 0.01
R1785:Acot11 UTSW 4 106762035 missense probably damaging 1.00
R1786:Acot11 UTSW 4 106762035 missense probably damaging 1.00
R1965:Acot11 UTSW 4 106749353 missense probably damaging 1.00
R2076:Acot11 UTSW 4 106770713 missense probably damaging 0.99
R2509:Acot11 UTSW 4 106755319 missense possibly damaging 0.90
R4558:Acot11 UTSW 4 106748366 missense probably damaging 1.00
R4565:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4567:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4847:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4881:Acot11 UTSW 4 106755305 critical splice donor site probably null
R5234:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5235:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5409:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5430:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5518:Acot11 UTSW 4 106750010 missense probably benign 0.24
R5763:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5787:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5788:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5933:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5934:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6093:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6104:Acot11 UTSW 4 106755897 missense probably damaging 1.00
R6726:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6727:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6734:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R7242:Acot11 UTSW 4 106762493 missense probably benign 0.00
R7257:Acot11 UTSW 4 106758402 missense probably damaging 1.00
R7360:Acot11 UTSW 4 106749351 missense possibly damaging 0.94
R8125:Acot11 UTSW 4 106760080 critical splice donor site probably null
R8393:Acot11 UTSW 4 106760193 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AGAAATGGCTCCTCTCTGGC -3'
(R):5'- TGTCATTGTCCCAGGGCTTC -3'

Sequencing Primer
(F):5'- TAGGGTTCTCCTAGCAGAGCAC -3'
(R):5'- CCATGGACAGTCTATCCTTAGGG -3'
Posted On2018-08-01