Incidental Mutation 'R6728:Agmat'
ID529943
Institutional Source Beutler Lab
Gene Symbol Agmat
Ensembl Gene ENSMUSG00000040706
Gene Nameagmatine ureohydrolase (agmatinase)
Synonyms5033405N08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081408; MGI: 1923236

Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6728 (G1)
Quality Score166.009
Status Not validated
Chromosome4
Chromosomal Location141746672-141759263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 141749586 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 101 (C101F)
Ref Sequence ENSEMBL: ENSMUSP00000040853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038161]
Predicted Effect probably benign
Transcript: ENSMUST00000038161
AA Change: C101F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040853
Gene: ENSMUSG00000040706
AA Change: C101F

DomainStartEndE-ValueType
low complexity region 44 62 N/A INTRINSIC
Pfam:Arginase 77 351 9.8e-85 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adcy5 T A 16: 35,157,165 V356E possibly damaging Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Cyp17a1 A G 19: 46,669,234 V293A probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kin G A 2: 10,090,148 R82Q possibly damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr1277 A T 2: 111,269,673 D231E probably benign Het
Olfr749 T C 14: 50,736,839 T108A possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Platr25 G A 13: 62,700,383 H222Y probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vegfc T C 8: 54,186,022 V401A probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Agmat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02870:Agmat APN 4 141746942 missense probably benign 0.02
3-1:Agmat UTSW 4 141749582 missense probably damaging 1.00
3-1:Agmat UTSW 4 141749610 missense possibly damaging 0.49
R1635:Agmat UTSW 4 141747069 missense probably damaging 1.00
R2103:Agmat UTSW 4 141755903 missense probably damaging 0.97
R2215:Agmat UTSW 4 141749588 missense probably benign 0.01
R3767:Agmat UTSW 4 141755962 missense probably benign 0.00
R4379:Agmat UTSW 4 141757491 missense probably benign 0.10
R5422:Agmat UTSW 4 141755833 missense probably damaging 1.00
R5640:Agmat UTSW 4 141755823 missense probably damaging 1.00
R5750:Agmat UTSW 4 141749687 missense probably benign 0.03
R6891:Agmat UTSW 4 141755881 missense probably benign 0.01
R7293:Agmat UTSW 4 141755935 nonsense probably null
R7298:Agmat UTSW 4 141746964 missense possibly damaging 0.90
R7361:Agmat UTSW 4 141746852 missense probably benign 0.23
R7585:Agmat UTSW 4 141749745 missense probably benign 0.09
Z1177:Agmat UTSW 4 141746979 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGATTGTTTTAGACCCAGTGGCG -3'
(R):5'- CAGCGAGGACATTCTGATAGG -3'

Sequencing Primer
(F):5'- TAGACCCAGTGGCGATATTGG -3'
(R):5'- GAGGACATTCTGATAGGCCTCTC -3'
Posted On2018-08-01