Incidental Mutation 'R6728:Hspbp1'
ID529945
Institutional Source Beutler Lab
Gene Symbol Hspbp1
Ensembl Gene ENSMUSG00000063802
Gene NameHSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6728 (G1)
Quality Score189.009
Status Not validated
Chromosome7
Chromosomal Location4660521-4685068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4660782 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 355 (M355L)
Ref Sequence ENSEMBL: ENSMUSP00000078886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064099] [ENSMUST00000079970] [ENSMUST00000205374] [ENSMUST00000205952]
Predicted Effect probably benign
Transcript: ENSMUST00000064099
SMART Domains Protein: ENSMUSP00000066736
Gene: ENSMUSG00000052296

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:SAPS 128 378 4.6e-69 PFAM
Pfam:SAPS 372 519 1.8e-39 PFAM
low complexity region 525 536 N/A INTRINSIC
low complexity region 618 639 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 842 855 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079970
AA Change: M355L

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078886
Gene: ENSMUSG00000063802
AA Change: M355L

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
Pfam:Fes1 43 138 2.5e-12 PFAM
SCOP:d1ee4a_ 150 302 2e-12 SMART
Blast:ARM 216 256 3e-11 BLAST
Blast:ARM 259 299 4e-13 BLAST
low complexity region 306 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205374
Predicted Effect probably benign
Transcript: ENSMUST00000205474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205812
Predicted Effect probably benign
Transcript: ENSMUST00000205952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206708
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show male infertility with an arrest of male meiosis, increased male germ cell apoptosis and azoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adcy5 T A 16: 35,157,165 V356E possibly damaging Het
Agmat G T 4: 141,749,586 C101F probably benign Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Cyp17a1 A G 19: 46,669,234 V293A probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kin G A 2: 10,090,148 R82Q possibly damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr1277 A T 2: 111,269,673 D231E probably benign Het
Olfr749 T C 14: 50,736,839 T108A possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Platr25 G A 13: 62,700,383 H222Y probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vegfc T C 8: 54,186,022 V401A probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Hspbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Hspbp1 APN 7 4664751 missense probably damaging 0.97
IGL02072:Hspbp1 APN 7 4677721 missense probably damaging 1.00
IGL02548:Hspbp1 APN 7 4681841 splice site probably benign
IGL02573:Hspbp1 APN 7 4677853 missense probably damaging 1.00
IGL03177:Hspbp1 APN 7 4664701 critical splice donor site probably null
IGL03181:Hspbp1 APN 7 4684364 missense probably damaging 1.00
R0568:Hspbp1 UTSW 7 4684432 nonsense probably null
R0670:Hspbp1 UTSW 7 4677736 missense probably damaging 1.00
R3013:Hspbp1 UTSW 7 4663484 missense probably benign 0.18
R3729:Hspbp1 UTSW 7 4677809 missense probably damaging 1.00
R3934:Hspbp1 UTSW 7 4664595 missense probably benign 0.41
R6031:Hspbp1 UTSW 7 4663466 missense probably benign 0.28
R6031:Hspbp1 UTSW 7 4663466 missense probably benign 0.28
R6034:Hspbp1 UTSW 7 4677712 missense probably damaging 1.00
R6034:Hspbp1 UTSW 7 4677712 missense probably damaging 1.00
R6797:Hspbp1 UTSW 7 4660782 missense possibly damaging 0.93
R6930:Hspbp1 UTSW 7 4684607 missense probably benign
R6992:Hspbp1 UTSW 7 4664715 missense probably benign 0.23
R7459:Hspbp1 UTSW 7 4684578 missense probably benign 0.00
R7525:Hspbp1 UTSW 7 4663436 missense probably damaging 1.00
R7608:Hspbp1 UTSW 7 4660822 missense possibly damaging 0.73
R7962:Hspbp1 UTSW 7 4681842 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTGAAGAGCAGTGTGGACATG -3'
(R):5'- TGATCATGATTGGCGCAGTG -3'

Sequencing Primer
(F):5'- GGCCAGCACCTTTCTCAG -3'
(R):5'- CAGTGGTCCTTGGGAAAGGC -3'
Posted On2018-08-01