Incidental Mutation 'R6728:Vegfc'
ID529946
Institutional Source Beutler Lab
Gene Symbol Vegfc
Ensembl Gene ENSMUSG00000031520
Gene Namevascular endothelial growth factor C
SynonymsVEGF-C
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6728 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location54077606-54187096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54186022 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 401 (V401A)
Ref Sequence ENSEMBL: ENSMUSP00000033919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033919]
Predicted Effect probably damaging
Transcript: ENSMUST00000033919
AA Change: V401A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033919
Gene: ENSMUSG00000031520
AA Change: V401A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PDGF 125 209 5.07e-48 SMART
Pfam:CXCXC 279 291 1.6e-7 PFAM
Pfam:CXCXC 327 339 1.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. The encoded protein promotes angiogenesis and endothelial cell growth, and can also affect the permeability of blood vessels. The proprotein is further cleaved into a fully processed form that can bind and activate VEGFR-2 and VEGFR-3 receptors. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutation of this gene affects the development of the lymphatic system. Homozygous inactivation is embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adcy5 T A 16: 35,157,165 V356E possibly damaging Het
Agmat G T 4: 141,749,586 C101F probably benign Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Cyp17a1 A G 19: 46,669,234 V293A probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kin G A 2: 10,090,148 R82Q possibly damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr1277 A T 2: 111,269,673 D231E probably benign Het
Olfr749 T C 14: 50,736,839 T108A possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Platr25 G A 13: 62,700,383 H222Y probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Vegfc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00658:Vegfc APN 8 54156948 splice site probably benign
IGL02120:Vegfc APN 8 54181401 missense possibly damaging 0.96
IGL03344:Vegfc APN 8 54157151 missense possibly damaging 0.64
R0620:Vegfc UTSW 8 54157139 missense probably benign 0.01
R1167:Vegfc UTSW 8 54186043 missense probably benign 0.06
R1826:Vegfc UTSW 8 54181312 missense possibly damaging 0.88
R4151:Vegfc UTSW 8 54077789 missense unknown
R4226:Vegfc UTSW 8 54159410 missense probably damaging 1.00
R4227:Vegfc UTSW 8 54159410 missense probably damaging 1.00
R4414:Vegfc UTSW 8 54181095 missense probably benign 0.02
R5963:Vegfc UTSW 8 54181284 missense probably benign
R6241:Vegfc UTSW 8 54181254 missense probably benign 0.00
R6368:Vegfc UTSW 8 54181230 missense probably damaging 1.00
R7044:Vegfc UTSW 8 54157045 missense possibly damaging 0.89
R7776:Vegfc UTSW 8 54077800 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGCCATGCTTTTAAAGGCTTTTC -3'
(R):5'- TCAATAAACACAGACTTGGGCC -3'

Sequencing Primer
(F):5'- TCCTCCCAAATTCTGAAAACTTAAG -3'
(R):5'- TAAACACAGACTTGGGCCTCTGTTAC -3'
Posted On2018-08-01