Incidental Mutation 'R6728:Platr25'
ID529952
Institutional Source Beutler Lab
Gene Symbol Platr25
Ensembl Gene ENSMUSG00000074863
Gene Namepluripotency associated transcript 25
SynonymsGm5665
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R6728 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location62671784-62760709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62700383 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 222 (H222Y)
Ref Sequence ENSEMBL: ENSMUSP00000152625 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000143260
Predicted Effect probably benign
Transcript: ENSMUST00000220733
Predicted Effect probably benign
Transcript: ENSMUST00000222303
Predicted Effect probably benign
Transcript: ENSMUST00000222477
Predicted Effect probably damaging
Transcript: ENSMUST00000222602
AA Change: H222Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223219
Predicted Effect probably benign
Transcript: ENSMUST00000223528
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adcy5 T A 16: 35,157,165 V356E possibly damaging Het
Agmat G T 4: 141,749,586 C101F probably benign Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Cyp17a1 A G 19: 46,669,234 V293A probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kin G A 2: 10,090,148 R82Q possibly damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr1277 A T 2: 111,269,673 D231E probably benign Het
Olfr749 T C 14: 50,736,839 T108A possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vegfc T C 8: 54,186,022 V401A probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Platr25
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6272:Platr25 UTSW 13 62672997 missense possibly damaging 0.82
R6379:Platr25 UTSW 13 62706237 missense probably damaging 1.00
R6548:Platr25 UTSW 13 62673809 missense possibly damaging 0.93
R6951:Platr25 UTSW 13 62705748 missense probably benign 0.00
R7365:Platr25 UTSW 13 62700905 missense probably benign
R7885:Platr25 UTSW 13 62700862 missense possibly damaging 0.91
R8114:Platr25 UTSW 13 62673924 missense possibly damaging 0.66
R8331:Platr25 UTSW 13 62700903 missense probably benign 0.01
R8514:Platr25 UTSW 13 62700772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGGGTTTCTTGCCAAT -3'
(R):5'- TCTCCAAAAGCATAGAAGGACAC -3'

Sequencing Primer
(F):5'- GCTTTTGAAGATGCCTGTGACATAC -3'
(R):5'- GCATAGAAGGACACACACAGG -3'
Posted On2018-08-01