Incidental Mutation 'R6728:Olfr749'
ID529954
Institutional Source Beutler Lab
Gene Symbol Olfr749
Ensembl Gene ENSMUSG00000059069
Gene Nameolfactory receptor 749
SynonymsGA_x6K02T2PMLR-6484046-6483105, MOR106-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6728 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50736171-50745094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50736839 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 108 (T108A)
Ref Sequence ENSEMBL: ENSMUSP00000150627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074674] [ENSMUST00000214290]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074674
AA Change: T108A

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074242
Gene: ENSMUSG00000059069
AA Change: T108A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.2e-53 PFAM
Pfam:7tm_1 40 289 7.3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214290
AA Change: T108A

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: A reporter allele shows expression of this olfactory receptor by embryonic day 15.5 and throughout olfactory development there is an increase in the numbers of expressing olfactory sensory neurons with expression localized to the dorsal main olfactory epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adcy5 T A 16: 35,157,165 V356E possibly damaging Het
Agmat G T 4: 141,749,586 C101F probably benign Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Cyp17a1 A G 19: 46,669,234 V293A probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kin G A 2: 10,090,148 R82Q possibly damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr1277 A T 2: 111,269,673 D231E probably benign Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Platr25 G A 13: 62,700,383 H222Y probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vegfc T C 8: 54,186,022 V401A probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Olfr749
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03188:Olfr749 APN 14 50736858 nonsense probably null
R0141:Olfr749 UTSW 14 50736383 missense possibly damaging 0.94
R0462:Olfr749 UTSW 14 50737097 missense probably benign
R1424:Olfr749 UTSW 14 50737064 missense probably benign
R1791:Olfr749 UTSW 14 50736687 small insertion probably benign
R1912:Olfr749 UTSW 14 50736778 missense probably damaging 1.00
R2069:Olfr749 UTSW 14 50736576 missense possibly damaging 0.51
R2171:Olfr749 UTSW 14 50736419 missense probably benign 0.33
R2176:Olfr749 UTSW 14 50736224 missense probably benign
R2184:Olfr749 UTSW 14 50736602 missense probably damaging 0.98
R3158:Olfr749 UTSW 14 50736814 missense probably benign 0.01
R5068:Olfr749 UTSW 14 50737074 missense probably benign 0.02
R5069:Olfr749 UTSW 14 50737074 missense probably benign 0.02
R5070:Olfr749 UTSW 14 50737074 missense probably benign 0.02
R5733:Olfr749 UTSW 14 50737052 missense probably benign 0.32
R6155:Olfr749 UTSW 14 50736619 missense probably benign 0.02
R7033:Olfr749 UTSW 14 50736707 missense possibly damaging 0.78
R7276:Olfr749 UTSW 14 50736730 missense possibly damaging 0.90
R7535:Olfr749 UTSW 14 50736665 missense probably benign 0.37
R8124:Olfr749 UTSW 14 50736286 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGGGTCCATGTCACAGAGG -3'
(R):5'- TGTGACTCACGTCTACATACCC -3'

Sequencing Primer
(F):5'- TCCATGTCACAGAGGAAGTGATC -3'
(R):5'- TCACGTCTACATACCCCCATG -3'
Posted On2018-08-01