Incidental Mutation 'R6728:Epha6'
ID529957
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene NameEph receptor A6
Synonymsm-ehk2, Hek12, Ehk2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6728 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59653483-60605531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60424835 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 334 (A334S)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068860
AA Change: A334S

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: A334S

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159383
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adcy5 T A 16: 35,157,165 V356E possibly damaging Het
Agmat G T 4: 141,749,586 C101F probably benign Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Cyp17a1 A G 19: 46,669,234 V293A probably benign Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kin G A 2: 10,090,148 R82Q possibly damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr1277 A T 2: 111,269,673 D231E probably benign Het
Olfr749 T C 14: 50,736,839 T108A possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Platr25 G A 13: 62,700,383 H222Y probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vegfc T C 8: 54,186,022 V401A probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8414:Epha6 UTSW 16 60005667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGCACAGTAGCATCTTC -3'
(R):5'- TAAACTCAACACTGAAATCCGTGAG -3'

Sequencing Primer
(F):5'- TCATACCCTGTACTGCAG -3'
(R):5'- TGGGGCCTATAGAAAGGAAAGG -3'
Posted On2018-08-01