Incidental Mutation 'R6728:Cyp17a1'
ID 529960
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Name cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms p450c17, Cyp17, steroid 17-alpha hydroxylase
MMRRC Submission 044846-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R6728 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 46655604-46661439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46657673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 293 (V293A)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
AlphaFold P27786
Predicted Effect probably benign
Transcript: ENSMUST00000026012
AA Change: V293A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: V293A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156577
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,384,645 (GRCm39) Y440C possibly damaging Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Adcy5 T A 16: 34,977,535 (GRCm39) V356E possibly damaging Het
Agmat G T 4: 141,476,897 (GRCm39) C101F probably benign Het
Aoc1l3 T C 6: 48,965,779 (GRCm39) S596P possibly damaging Het
Atl1 T C 12: 69,994,324 (GRCm39) V276A possibly damaging Het
Barhl1 G A 2: 28,805,495 (GRCm39) P66L probably benign Het
Camk4 A T 18: 33,317,992 (GRCm39) E383V probably benign Het
Cap2 G A 13: 46,793,335 (GRCm39) E234K possibly damaging Het
Col24a1 A T 3: 145,020,957 (GRCm39) M443L probably benign Het
Epha6 C A 16: 60,245,198 (GRCm39) A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 (GRCm39) S1162P probably benign Het
Hspbp1 T A 7: 4,663,781 (GRCm39) M355L possibly damaging Het
Insrr C T 3: 87,720,873 (GRCm39) R1044C probably damaging Het
Kin G A 2: 10,094,959 (GRCm39) R82Q possibly damaging Het
Ninl G T 2: 150,817,777 (GRCm39) S129* probably null Het
Or11h4 T C 14: 50,974,296 (GRCm39) T108A possibly damaging Het
Or4k35 A T 2: 111,100,018 (GRCm39) D231E probably benign Het
Paqr5 C T 9: 61,871,065 (GRCm39) R171Q probably damaging Het
Platr25 G A 13: 62,848,197 (GRCm39) H222Y probably damaging Het
Plcb2 G T 2: 118,554,171 (GRCm39) S94Y probably damaging Het
Rock2 T C 12: 17,011,737 (GRCm39) Y722H probably benign Het
Sh3kbp1 A T X: 158,624,176 (GRCm39) E39D probably benign Homo
Thsd4 T C 9: 59,904,480 (GRCm39) D572G probably benign Het
Tnrc6b T A 15: 80,802,727 (GRCm39) L1510H probably damaging Het
Tsc2 A G 17: 24,840,098 (GRCm39) S433P probably damaging Het
Vegfc T C 8: 54,639,057 (GRCm39) V401A probably damaging Het
Vwa3b A G 1: 37,196,453 (GRCm39) M27V probably damaging Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46,659,495 (GRCm39) missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46,659,110 (GRCm39) missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46,659,531 (GRCm39) missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46,661,046 (GRCm39) nonsense probably null
IGL02349:Cyp17a1 APN 19 46,655,936 (GRCm39) missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46,661,005 (GRCm39) missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46,657,790 (GRCm39) missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46,661,050 (GRCm39) missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46,655,796 (GRCm39) missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46,659,474 (GRCm39) missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46,658,162 (GRCm39) missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4446:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46,658,990 (GRCm39) missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46,661,093 (GRCm39) missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46,661,095 (GRCm39) missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46,657,761 (GRCm39) missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46,661,159 (GRCm39) missense probably benign 0.17
R6729:Cyp17a1 UTSW 19 46,659,020 (GRCm39) missense probably benign
R7025:Cyp17a1 UTSW 19 46,659,419 (GRCm39) missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46,659,134 (GRCm39) missense probably benign
R8056:Cyp17a1 UTSW 19 46,659,030 (GRCm39) missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46,656,516 (GRCm39) missense probably benign 0.09
R8735:Cyp17a1 UTSW 19 46,659,533 (GRCm39) critical splice acceptor site probably null
R8737:Cyp17a1 UTSW 19 46,658,166 (GRCm39) missense probably benign 0.09
R9091:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9270:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9364:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
R9554:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
X0020:Cyp17a1 UTSW 19 46,659,459 (GRCm39) missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46,661,098 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TATCTGTACAGAAGGCTCCAGG -3'
(R):5'- ACACCTTGCTGTGTCTCTGG -3'

Sequencing Primer
(F):5'- TACAGAAGGCTCCAGGCATTGC -3'
(R):5'- ATGTTGGAAGTGAGGCTCCC -3'
Posted On 2018-08-01