Incidental Mutation 'R6728:Cyp17a1'
ID 529960
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Name cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms steroid 17-alpha hydroxylase, p450c17, Cyp17
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R6728 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 46667165-46672974 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46669234 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 293 (V293A)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
AlphaFold P27786
Predicted Effect probably benign
Transcript: ENSMUST00000026012
AA Change: V293A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: V293A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156577
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adcy5 T A 16: 35,157,165 V356E possibly damaging Het
Agmat G T 4: 141,749,586 C101F probably benign Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kin G A 2: 10,090,148 R82Q possibly damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr1277 A T 2: 111,269,673 D231E probably benign Het
Olfr749 T C 14: 50,736,839 T108A possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Platr25 G A 13: 62,700,383 H222Y probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vegfc T C 8: 54,186,022 V401A probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46671056 missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46670671 missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46671092 missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46672607 nonsense probably null
IGL02349:Cyp17a1 APN 19 46667497 missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46672566 missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46669351 missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46672611 missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46667357 missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46671035 missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46669723 missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4446:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46670551 missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46672654 missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46672656 missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46669322 missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46672720 missense probably benign 0.17
R6729:Cyp17a1 UTSW 19 46670581 missense probably benign
R7025:Cyp17a1 UTSW 19 46670980 missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46670695 missense probably benign
R8056:Cyp17a1 UTSW 19 46670591 missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46668077 missense probably benign 0.09
R8735:Cyp17a1 UTSW 19 46671094 critical splice acceptor site probably null
R8737:Cyp17a1 UTSW 19 46669727 missense probably benign 0.09
R9091:Cyp17a1 UTSW 19 46667591 missense probably benign 0.00
R9270:Cyp17a1 UTSW 19 46667591 missense probably benign 0.00
R9364:Cyp17a1 UTSW 19 46668726 missense probably damaging 1.00
R9554:Cyp17a1 UTSW 19 46668726 missense probably damaging 1.00
X0020:Cyp17a1 UTSW 19 46671020 missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46672659 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TATCTGTACAGAAGGCTCCAGG -3'
(R):5'- ACACCTTGCTGTGTCTCTGG -3'

Sequencing Primer
(F):5'- TACAGAAGGCTCCAGGCATTGC -3'
(R):5'- ATGTTGGAAGTGAGGCTCCC -3'
Posted On 2018-08-01