Incidental Mutation 'R6728:Sh3kbp1'
ID529961
Institutional Source Beutler Lab
Gene Symbol Sh3kbp1
Ensembl Gene ENSMUSG00000040990
Gene NameSH3-domain kinase binding protein 1
SynonymsIN85, 5830464D22Rik, 1700125L08Rik, Seta, Ruk, 1200007H22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R6728 (G1)
Quality Score221.999
Status Not validated
ChromosomeX
Chromosomal Location159627272-159978069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 159841180 bp
ZygosityHomozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 39 (E39D)
Ref Sequence ENSEMBL: ENSMUSP00000108072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073094] [ENSMUST00000080394] [ENSMUST00000112451] [ENSMUST00000112453] [ENSMUST00000112456] [ENSMUST00000123433] [ENSMUST00000141354]
PDB Structure
Solution structure of the SH3 domain of SH3-domain kinase binding protein 1 [SOLUTION NMR]
Solution structure of the third SH3 domain of SH3-domain kinase binding protein 1 (Regulator of ubiquitous kinase, Ruk) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000073094
SMART Domains Protein: ENSMUSP00000072840
Gene: ENSMUSG00000040990

DomainStartEndE-ValueType
SH3 2 57 2.69e-22 SMART
SH3 101 156 5.69e-21 SMART
low complexity region 221 239 N/A INTRINSIC
SH3 314 371 1.26e-22 SMART
low complexity region 381 387 N/A INTRINSIC
low complexity region 421 431 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 535 556 N/A INTRINSIC
low complexity region 600 623 N/A INTRINSIC
coiled coil region 647 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080394
SMART Domains Protein: ENSMUSP00000079257
Gene: ENSMUSG00000040990

DomainStartEndE-ValueType
SH3 64 119 5.69e-21 SMART
low complexity region 140 158 N/A INTRINSIC
SH3 233 290 1.26e-22 SMART
low complexity region 300 306 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
low complexity region 355 370 N/A INTRINSIC
low complexity region 454 475 N/A INTRINSIC
low complexity region 519 542 N/A INTRINSIC
coiled coil region 566 623 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112447
Predicted Effect probably benign
Transcript: ENSMUST00000112451
SMART Domains Protein: ENSMUSP00000108070
Gene: ENSMUSG00000040990

DomainStartEndE-ValueType
SH3 32 89 1.26e-22 SMART
low complexity region 99 105 N/A INTRINSIC
low complexity region 139 149 N/A INTRINSIC
low complexity region 154 169 N/A INTRINSIC
low complexity region 253 274 N/A INTRINSIC
low complexity region 318 341 N/A INTRINSIC
coiled coil region 365 422 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112453
AA Change: E39D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000108072
Gene: ENSMUSG00000040990
AA Change: E39D

DomainStartEndE-ValueType
SH3 69 126 1.26e-22 SMART
low complexity region 136 142 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
low complexity region 290 311 N/A INTRINSIC
low complexity region 355 378 N/A INTRINSIC
coiled coil region 402 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112456
SMART Domains Protein: ENSMUSP00000108075
Gene: ENSMUSG00000040990

DomainStartEndE-ValueType
SH3 2 57 2.69e-22 SMART
SH3 101 156 5.69e-21 SMART
low complexity region 177 195 N/A INTRINSIC
SH3 270 327 1.26e-22 SMART
low complexity region 337 343 N/A INTRINSIC
low complexity region 377 387 N/A INTRINSIC
low complexity region 392 407 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 556 579 N/A INTRINSIC
coiled coil region 603 660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123433
SMART Domains Protein: ENSMUSP00000114799
Gene: ENSMUSG00000040990

DomainStartEndE-ValueType
SH3 42 97 5.69e-21 SMART
low complexity region 118 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141354
SMART Domains Protein: ENSMUSP00000114262
Gene: ENSMUSG00000040990

DomainStartEndE-ValueType
SH3 64 119 5.69e-21 SMART
low complexity region 140 158 N/A INTRINSIC
SH3 233 290 1.26e-22 SMART
low complexity region 300 306 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
low complexity region 355 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150433
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that contains three N-terminal Src homology domains, a proline rich region and a C-terminal coiled-coil domain. The encoded protein facilitates protein-protein interactions and has been implicated in numerous cellular processes including apoptosis, cytoskeletal rearrangement, cell adhesion and in the regulation of clathrin-dependent endocytosis. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele have an increased lean body mass, increased dopamine in the striatum and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adcy5 T A 16: 35,157,165 V356E possibly damaging Het
Agmat G T 4: 141,749,586 C101F probably benign Het
Atl1 T C 12: 69,947,550 V276A possibly damaging Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Camk4 A T 18: 33,184,939 E383V probably benign Het
Cap2 G A 13: 46,639,859 E234K possibly damaging Het
Col24a1 A T 3: 145,315,196 M443L probably benign Het
Cyp17a1 A G 19: 46,669,234 V293A probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Frmpd1 T C 4: 45,284,664 S1162P probably benign Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kin G A 2: 10,090,148 R82Q possibly damaging Het
Ninl G T 2: 150,975,857 S129* probably null Het
Olfr1277 A T 2: 111,269,673 D231E probably benign Het
Olfr749 T C 14: 50,736,839 T108A possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Platr25 G A 13: 62,700,383 H222Y probably damaging Het
Plcb2 G T 2: 118,723,690 S94Y probably damaging Het
Rock2 T C 12: 16,961,736 Y722H probably benign Het
Svs1 T C 6: 48,988,845 S596P possibly damaging Het
Thsd4 T C 9: 59,997,197 D572G probably benign Het
Tnrc6b T A 15: 80,918,526 L1510H probably damaging Het
Tsc2 A G 17: 24,621,124 S433P probably damaging Het
Vegfc T C 8: 54,186,022 V401A probably damaging Het
Vwa3b A G 1: 37,157,372 M27V probably damaging Het
Other mutations in Sh3kbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02244:Sh3kbp1 APN X 159803728 missense probably damaging 1.00
R2145:Sh3kbp1 UTSW X 159824496 missense probably benign 0.09
R6726:Sh3kbp1 UTSW X 159841180 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCATGTCACAGAGATGTTTAGC -3'
(R):5'- CATAAGCCTTTACTTATCCTGTGG -3'

Sequencing Primer
(F):5'- GCAATTACAGATGTTTGTGCAGTC -3'
(R):5'- ACTTATCCTGTGGTTTCTTTAGGG -3'
Posted On2018-08-01