Incidental Mutation 'R6729:Nceh1'
ID529966
Institutional Source Beutler Lab
Gene Symbol Nceh1
Ensembl Gene ENSMUSG00000027698
Gene Nameneutral cholesterol ester hydrolase 1
SynonymsAadacl1, mKIAA1363, B230106I24Rik, CPO-BP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6729 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location27182965-27284608 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 27241271 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 227 (L227*)
Ref Sequence ENSEMBL: ENSMUSP00000045864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046515] [ENSMUST00000091284]
Predicted Effect probably null
Transcript: ENSMUST00000046515
AA Change: L227*
SMART Domains Protein: ENSMUSP00000045864
Gene: ENSMUSG00000027698
AA Change: L227*

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Abhydrolase_3 109 290 6.6e-36 PFAM
Pfam:Abhydrolase_3 294 382 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091284
SMART Domains Protein: ENSMUSP00000088829
Gene: ENSMUSG00000027698

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Abhydrolase_3 109 152 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140872
Meta Mutation Damage Score 0.9753 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal organophosphorus metabolism and cholesterol homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,188,601 probably null Het
Acad12 A T 5: 121,607,935 H230Q probably damaging Het
AI182371 G T 2: 35,084,705 probably benign Het
Ank3 T C 10: 69,808,925 V73A probably damaging Het
Apbb1 A T 7: 105,565,381 M28K probably damaging Het
Atp6v1f A G 6: 29,467,965 D50G probably benign Het
Cdkal1 G A 13: 29,474,695 T356M probably damaging Het
Clca1 A G 3: 145,005,966 I756T probably damaging Het
Cyp17a1 A G 19: 46,670,581 V207A probably benign Het
Dnah7c A G 1: 46,672,521 E2636G possibly damaging Het
Gm13090 A T 4: 151,089,628 probably benign Het
Nedd9 A G 13: 41,315,802 M625T probably damaging Het
Olfr1426 T A 19: 12,088,496 M99L probably benign Het
Olfr148 A T 9: 39,613,773 M69L probably benign Het
Olfr464 G A 11: 87,914,850 Q19* probably null Het
Olfr920 A G 9: 38,755,828 I47V probably benign Het
Pcsk4 T C 10: 80,325,101 N297S probably damaging Het
Psg21 T A 7: 18,652,591 I157F probably damaging Het
Rabep2 T C 7: 126,440,197 V294A probably benign Het
Rsph1 A G 17: 31,277,252 S2P unknown Het
Sacs A G 14: 61,210,518 K3338E probably damaging Het
Slc35f4 T G 14: 49,318,960 N112T probably benign Het
Slc43a3 T C 2: 84,938,285 F83L probably damaging Het
Slc6a15 T C 10: 103,393,914 V154A probably damaging Het
Synj2 T A 17: 5,986,014 M1K probably null Het
Tcp1 G A 17: 12,923,253 R378Q probably damaging Het
Tead2 A G 7: 45,217,234 T6A probably benign Het
Tpte G T 8: 22,355,475 V514L probably damaging Het
Trpm6 A G 19: 18,830,297 N1069D probably damaging Het
Uhrf1bp1l T A 10: 89,805,684 S906T probably benign Het
Vmn2r105 C A 17: 20,208,343 G824C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp934 A T 13: 62,492,932 N2K probably damaging Het
Other mutations in Nceh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Nceh1 APN 3 27241313 missense probably damaging 1.00
IGL02113:Nceh1 APN 3 27222891 missense probably damaging 1.00
cerdo UTSW 3 27241271 nonsense probably null
BB006:Nceh1 UTSW 3 27279247 missense probably benign 0.00
BB016:Nceh1 UTSW 3 27279247 missense probably benign 0.00
R0281:Nceh1 UTSW 3 27222804 missense possibly damaging 0.64
R0854:Nceh1 UTSW 3 27241319 missense probably damaging 1.00
R1562:Nceh1 UTSW 3 27239552 missense probably damaging 1.00
R1689:Nceh1 UTSW 3 27226082 missense probably damaging 0.99
R1918:Nceh1 UTSW 3 27183175 missense probably damaging 1.00
R2851:Nceh1 UTSW 3 27241355 missense probably damaging 1.00
R3959:Nceh1 UTSW 3 27279196 missense probably benign 0.01
R4420:Nceh1 UTSW 3 27241649 missense probably damaging 1.00
R4686:Nceh1 UTSW 3 27241669 missense probably damaging 1.00
R5165:Nceh1 UTSW 3 27241528 missense probably benign
R5243:Nceh1 UTSW 3 27241688 missense probably damaging 1.00
R5255:Nceh1 UTSW 3 27183139 missense probably damaging 0.96
R5598:Nceh1 UTSW 3 27226099 missense probably benign 0.01
R6076:Nceh1 UTSW 3 27279195 missense probably benign 0.00
R6337:Nceh1 UTSW 3 27222807 missense probably damaging 0.96
R6744:Nceh1 UTSW 3 27241789 missense probably damaging 1.00
R7618:Nceh1 UTSW 3 27183217 critical splice donor site probably null
R7749:Nceh1 UTSW 3 27207382 missense probably benign
R7929:Nceh1 UTSW 3 27279247 missense probably benign 0.00
R8040:Nceh1 UTSW 3 27241225 missense probably benign 0.00
R8350:Nceh1 UTSW 3 27239664 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTTAGGGATTATCCAGTAGCTTG -3'
(R):5'- TTTTGATGGACGAGGGCAAC -3'

Sequencing Primer
(F):5'- ATCCAGTAGCTTGGTGTGC -3'
(R):5'- GCAACAGGGATGTCCAGTC -3'
Posted On2018-08-01