Incidental Mutation 'R6729:Clca1'
ID529967
Institutional Source Beutler Lab
Gene Symbol Clca1
Ensembl Gene ENSMUSG00000028255
Gene Namechloride channel accessory 1
Synonymsgob-5, gob5, Clca3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6729 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location145003817-145032776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145005966 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 756 (I756T)
Ref Sequence ENSEMBL: ENSMUSP00000029919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029919]
Predicted Effect probably damaging
Transcript: ENSMUST00000029919
AA Change: I756T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255
AA Change: I756T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
VWA 305 478 5.05e-19 SMART
Blast:FN3 753 852 2e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195901
Meta Mutation Damage Score 0.3963 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated mucin response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,188,601 probably null Het
Acad12 A T 5: 121,607,935 H230Q probably damaging Het
AI182371 G T 2: 35,084,705 probably benign Het
Ank3 T C 10: 69,808,925 V73A probably damaging Het
Apbb1 A T 7: 105,565,381 M28K probably damaging Het
Atp6v1f A G 6: 29,467,965 D50G probably benign Het
Cdkal1 G A 13: 29,474,695 T356M probably damaging Het
Cyp17a1 A G 19: 46,670,581 V207A probably benign Het
Dnah7c A G 1: 46,672,521 E2636G possibly damaging Het
Gm13090 A T 4: 151,089,628 probably benign Het
Nceh1 T A 3: 27,241,271 L227* probably null Het
Nedd9 A G 13: 41,315,802 M625T probably damaging Het
Olfr1426 T A 19: 12,088,496 M99L probably benign Het
Olfr148 A T 9: 39,613,773 M69L probably benign Het
Olfr464 G A 11: 87,914,850 Q19* probably null Het
Olfr920 A G 9: 38,755,828 I47V probably benign Het
Pcsk4 T C 10: 80,325,101 N297S probably damaging Het
Psg21 T A 7: 18,652,591 I157F probably damaging Het
Rabep2 T C 7: 126,440,197 V294A probably benign Het
Rsph1 A G 17: 31,277,252 S2P unknown Het
Sacs A G 14: 61,210,518 K3338E probably damaging Het
Slc35f4 T G 14: 49,318,960 N112T probably benign Het
Slc43a3 T C 2: 84,938,285 F83L probably damaging Het
Slc6a15 T C 10: 103,393,914 V154A probably damaging Het
Synj2 T A 17: 5,986,014 M1K probably null Het
Tcp1 G A 17: 12,923,253 R378Q probably damaging Het
Tead2 A G 7: 45,217,234 T6A probably benign Het
Tpte G T 8: 22,355,475 V514L probably damaging Het
Trpm6 A G 19: 18,830,297 N1069D probably damaging Het
Uhrf1bp1l T A 10: 89,805,684 S906T probably benign Het
Vmn2r105 C A 17: 20,208,343 G824C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp934 A T 13: 62,492,932 N2K probably damaging Het
Other mutations in Clca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca1 APN 3 145027899 missense probably benign 0.01
IGL00862:Clca1 APN 3 145024571 missense possibly damaging 0.89
IGL00895:Clca1 APN 3 145024596 missense probably damaging 1.00
IGL00969:Clca1 APN 3 145008958 missense possibly damaging 0.80
IGL01398:Clca1 APN 3 145016751 missense possibly damaging 0.81
IGL01447:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01455:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01457:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01458:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01462:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01473:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01488:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01490:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01632:Clca1 APN 3 145027441 missense probably damaging 1.00
IGL01896:Clca1 APN 3 145015677 missense possibly damaging 0.79
IGL02411:Clca1 APN 3 145028002 missense possibly damaging 0.89
IGL03156:Clca1 APN 3 145013911 missense probably damaging 1.00
R0472:Clca1 UTSW 3 145027345 missense probably damaging 1.00
R0571:Clca1 UTSW 3 145007789 missense probably damaging 1.00
R0585:Clca1 UTSW 3 145032625 missense probably benign 0.16
R0586:Clca1 UTSW 3 145032589 missense probably benign 0.45
R0791:Clca1 UTSW 3 145004854 missense probably benign 0.01
R1187:Clca1 UTSW 3 145009743 missense probably benign 0.30
R1713:Clca1 UTSW 3 145024546 missense probably benign 0.00
R1739:Clca1 UTSW 3 145007778 missense probably benign 0.00
R2079:Clca1 UTSW 3 145007773 missense possibly damaging 0.80
R2129:Clca1 UTSW 3 145016765 missense probably damaging 1.00
R2178:Clca1 UTSW 3 145006102 missense probably damaging 1.00
R2234:Clca1 UTSW 3 145009068 missense possibly damaging 0.93
R2235:Clca1 UTSW 3 145009068 missense possibly damaging 0.93
R2240:Clca1 UTSW 3 145008985 missense probably damaging 1.00
R3751:Clca1 UTSW 3 145018663 missense probably benign 0.01
R3974:Clca1 UTSW 3 145032639 missense probably damaging 1.00
R3975:Clca1 UTSW 3 145032639 missense probably damaging 1.00
R4409:Clca1 UTSW 3 145006027 missense probably damaging 1.00
R4586:Clca1 UTSW 3 145016858 missense probably damaging 1.00
R4751:Clca1 UTSW 3 145004848 missense possibly damaging 0.89
R4894:Clca1 UTSW 3 145013901 missense probably damaging 0.99
R4909:Clca1 UTSW 3 145024563 missense probably damaging 1.00
R4916:Clca1 UTSW 3 145015844 missense probably benign 0.01
R4941:Clca1 UTSW 3 145015653 missense probably damaging 1.00
R4942:Clca1 UTSW 3 145004763 missense probably benign 0.02
R5044:Clca1 UTSW 3 145007928 splice site probably null
R5451:Clca1 UTSW 3 145027986 missense probably damaging 1.00
R5618:Clca1 UTSW 3 145004977 missense probably benign 0.00
R5724:Clca1 UTSW 3 145009072 missense probably benign 0.01
R5898:Clca1 UTSW 3 145016761 missense possibly damaging 0.89
R6238:Clca1 UTSW 3 145008955 missense probably benign 0.09
R6590:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6591:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6592:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6690:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6691:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6805:Clca1 UTSW 3 145018667 missense probably damaging 1.00
R7106:Clca1 UTSW 3 145027429 missense probably damaging 0.98
R7121:Clca1 UTSW 3 145011806 missense probably damaging 1.00
R7127:Clca1 UTSW 3 145006045 missense probably damaging 1.00
R7212:Clca1 UTSW 3 145005966 missense probably damaging 1.00
R7444:Clca1 UTSW 3 145027432 missense probably damaging 1.00
R7446:Clca1 UTSW 3 145027427 missense possibly damaging 0.65
R7535:Clca1 UTSW 3 145018567 missense probably damaging 0.99
X0020:Clca1 UTSW 3 145032660 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAGCCATTTGAGATTCCCGC -3'
(R):5'- TTGGGGTCTTGTTACCAGAC -3'

Sequencing Primer
(F):5'- ATTTGAGATTCCCGCCTTCTG -3'
(R):5'- CTTGTTACCAGACTTTAAAGTGGG -3'
Posted On2018-08-01